--- Log opened Mon Mar 26 00:00:05 2012 --- Day changed Mon Mar 26 2012 20120326 00:00:05< tuxlobby> 20120326 00:00:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 00:00:19< lobby> kickass ended game: "Rob’s game" (8064) at turn: 16 with reason: 'game over'. (socket: 12311) 20120326 00:00:39< dicplobby> laycastle ended game: "Battaglia di cartman" (24) at turn: 1 with reason: 'aborted'. (socket: 58) 20120326 00:01:20< lobby> Minion started game: "Minion’s game" (8191) with: Minion, hiu, Geneza. Settings: map: 3pSurvival era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 00:02:11< lobby> Anibal started game: "Anibal’s game" (8190) with: Anibal, Flapjacks, DrunkenStyle, jr49. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 00:02:12< lobby> mortalenemy ended game: "Eldirian’s game" (8075) at turn: 19 with reason: 'out of sync'. (socket: 12112) 20120326 00:02:24< dicplobby> 20120326 00:02:24 Statistics: number_of_games = 1 number_of_users = 2 lobby_users = 1 20120326 00:02:25< lobby> 20120326 00:02:25 Statistics: number_of_games = 50 number_of_users = 173 lobby_users = 30 20120326 00:02:42< lobby> TheVeneGuy ended game: "TwistedClock’s game" (8174) at turn: 7 with reason: 'aborted'. (socket: 12491) 20120326 00:03:10< lobby> blobbytheblob ended game: "ian is a nub" (8187) at turn: 1 with reason: 'aborted'. (socket: 12553) 20120326 00:03:40< dicplobby> cartman started game: "Battaglia di cartman" (25) with: cartman, laycastle. Settings: map: multiplayer_Random_Map era: Ageless Era XP: 30 GPV: fog: shroud: observers: yes timer: 20120326 00:03:55< lobby> Julie ended game: "lummigos’s game" (8160) at turn: 9 with reason: 'aborted'. (socket: 12174) 20120326 00:04:02< lobby> lummigos started game: "lummigos’s game" (8195) with: lummigos, Julie. Settings: map: elf_war_2_The_Battle_of_Vesna_Valley_easy era: era_default XP: GPV: fog: shroud: observers: no shuffle: no timer: 20120326 00:04:19< lobby> ChrisH ended game: "2v2" (8150) at turn: 8 with reason: 'aborted'. (socket: 12132) 20120326 00:04:28< lobby> rehost 20120326 00:05:00< lobby> Lilly ended game: "random" (8158) at turn: 8 with reason: 'game over'. (socket: 12361) 20120326 00:05:00< lobby> nate-the-great started game: "nate-the-great’s game" (8196) with: nate-the-great. Settings: map: isars_blasphemy era: Ageless Era XP: 60 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 00:05:05< tuxlobby> 20120326 00:05:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 00:05:35< lobby> Starbuck ended game: "DSG’s game" (8080) at turn: 16 with reason: 'aborted'. (socket: 12363) 20120326 00:05:49< lobby> Martozael ended game: "FFA, EoHS" (8182) at turn: 3 with reason: 'aborted'. (socket: 12408) 20120326 00:06:00< lobby> TwistedClock started game: "TwistedClock’s game" (8194) with: TwistedClock, TheVeneGuy. Settings: map: multiplayer_Den_of_Onis era: era_default XP: 50 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 00:06:00< lobby> ilikeblue949 started game: "ilikeblue949’s game" (8197) with: ilikeblue949. Settings: map: SXC_Stronghold_0.2.98 era: Ageless Heroes XP: 130 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 00:06:34< lobby> Gregor started game: "EoHS, FFA" (8198) with: Gregor, jugador, Isorak. Settings: map: multiplayer_Alirok_Marsh era: era_of_high_sorcery XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 00:06:47< lobby> AxtImWalde ended game: "AxtImWaldes Partie" (8091) at turn: 27 with reason: 'game over'. (socket: 11972) 20120326 00:07:06< lobby> Julie ended game: "lummigos’s game" (8195) at turn: 9 with reason: 'aborted'. (socket: 12174) 20120326 00:07:24< dicplobby> 20120326 00:07:24 Statistics: number_of_games = 1 number_of_users = 2 lobby_users = 0 20120326 00:07:24< lobby> lummigos started game: "lummigos’s game" (8202) with: lummigos, Julie. Settings: map: elf_war_2_The_Battle_of_Vesna_Valley_easy era: era_default XP: GPV: fog: shroud: observers: no shuffle: no timer: 20120326 00:07:25< lobby> 20120326 00:07:25 Statistics: number_of_games = 49 number_of_users = 163 lobby_users = 30 20120326 00:08:11< lobby> Snowman ended game: "Unite’s game" (7959) at turn: 23 with reason: 'game over'. (socket: 12188) 20120326 00:08:30< lobby> G 20120326 00:08:43< lobby> TheYoshi ended game: "TheYoshi’s game" (8157) at turn: 11 with reason: 'aborted'. (socket: 12489) 20120326 00:08:54< lobby> :help 20120326 00:09:40< lobby> lummigos advanced game: "lummigos’s game" (8202) with: lummigos, Julie. Settings: map: elf_war_3_Inside_the_Mountain_easy era: XP: 100 GPV: fog: shroud: observers: shuffle: timer: 20120326 00:09:57< lobby> Lucaness started game: "Lucaness’s game" (8203) with: Lucaness, girwasx. Settings: map: multiplayer_Random_Map era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 00:10:05< tuxlobby> 20120326 00:10:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 00:10:29< lobby> trenton ended game: "ian is a nub" (8142) at turn: 5 with reason: 'game over' and disconnected. (socket: 12471) 20120326 00:10:30< lobby> ilikeblue949 ended game: "ilikeblue949’s game" (8197) at turn: 3 with reason: 'aborted'. (socket: 12536) 20120326 00:10:36< lobby> Isorak ended game: "EoHS, FFA" (8198) at turn: 1 with reason: 'aborted'. (socket: 12515) 20120326 00:10:58< lobby> -Gomes-BR- ended game: "Ladder (1450) -- registered players only -- " (8095) at turn: 22 with reason: 'game over'. (socket: 12366) 20120326 00:11:04< lobby> qqer um 20120326 00:11:16< lobby> <-Gomes-BR-> Danni crio 20120326 00:11:19< lobby> o q vcs estão pretendendo? 20120326 00:11:19< lobby> Ultron_Lives advanced game: "Ultron_Lives’s game" (8121) with: Ultron_Lives, Shadwiser, universe. Settings: map: TGQ_Scenario2_Ravine era: XP: 100 GPV: fog: shroud: observers: shuffle: timer: 20120326 00:11:35< lobby> ilikeblue949 started game: "ilikeblue949’s game" (8206) with: ilikeblue949. Settings: map: SXC_Stronghold_0.2.98 era: Ageless Heroes XP: 130 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 00:11:52< lobby> ChrisH started game: "ChrisH’s game" (8200) with: ChrisH, Spieler34, janizz, Mostovoi13. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 00:11:52< lobby> Danniel_BR started game: "nome de Danniel_BR" (8208) with: Danniel_BR, LuizBR, BR_Scotta, -Gomes-BR-. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 00:12:19< lobby> Julie ended game: "lummigos’s game" (8202) at turn: 1 with reason: 'game over'. (socket: 12174) 20120326 00:12:25< dicplobby> 20120326 00:12:24 Statistics: number_of_games = 1 number_of_users = 2 lobby_users = 0 20120326 00:12:25< lobby> 20120326 00:12:25 Statistics: number_of_games = 45 number_of_users = 161 lobby_users = 30 20120326 00:13:08< lobby> Gregor started game: "Era of High Sorcery, FFA" (8207) with: Gregor, Isorak, Roger. Settings: map: multiplayer_Alirok_Marsh era: era_of_high_sorcery XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 00:14:44< lobby> Hanswuerstchen ended game: "Jointas Partie" (8066) at turn: 43 with reason: 'game over'. (socket: 12345) 20120326 00:15:05< tuxlobby> 20120326 00:15:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 00:15:13< lobby> Buroku ended game: "Ub3rPenguin’s game" (8129) at turn: 11 with reason: 'aborted'. (socket: 12426) 20120326 00:15:14< lobby> Jointa started game: "Jointas Partie" (8210) with: Jointa, Hanswuerstchen. Settings: map: multiplayer_2p_Dark_Forecast era: era_default XP: GPV: fog: shroud: observers: no shuffle: no timer: 20120326 00:15:47< lobby> Irmao-Verdade started game: "1 vs 1 . 2 sides each player" (8205) with: Irmao-Verdade, IcE_SkiLLz. Settings: map: multiplayer_4p_Underworld era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 00:16:08< lobby> nate-the-great ended game: "nate-the-great’s game" (8196) at turn: 18 with reason: 'game over'. (socket: 11490) 20120326 00:17:24< dicplobby> 20120326 00:17:24 Statistics: number_of_games = 1 number_of_users = 2 lobby_users = 0 20120326 00:17:25< lobby> 20120326 00:17:25 Statistics: number_of_games = 45 number_of_users = 153 lobby_users = 30 20120326 00:17:42< lobby> sabri ended game: "Battaglia di sabri" (8136) at turn: 11 with reason: 'aborted' and disconnected. (socket: 12451) 20120326 00:19:09< lobby> ilikeblue949 ended game: "ilikeblue949’s game" (8206) at turn: 4 with reason: 'aborted'. (socket: 12536) 20120326 00:19:47< lobby> ilikeblue949 started game: "ilikeblue949’s game" (8213) with: ilikeblue949. Settings: map: SXC_Stronghold_0.2.98 era: Ageless Heroes XP: 130 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 00:19:54< lobby> Jointa ended game: "Jointas Partie" (8210) at turn: 43 with reason: 'game over'. (socket: 12010) 20120326 00:19:56< lobby> JayEnfield started game: "JayEnfield’s game" (8212) with: JayEnfield, KimmyNL. Settings: map: multiplayer_2p_Dark_Forecast era: era_default XP: 100 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 00:20:05< tuxlobby> 20120326 00:20:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 00:20:23< lobby> manix ended game: "bloodymarx’s game" (8141) at turn: 9 with reason: 'aborted'. (socket: 12418) 20120326 00:20:26< lobby> Jointa started game: "Jointas Partie" (8214) with: Jointa, Hanswuerstchen. Settings: map: multiplayer_2p_Dark_Forecast era: era_default XP: GPV: fog: shroud: observers: no shuffle: no timer: 20120326 00:22:18< lobby> saintmike started game: "saintmike’s game" (8216) with: saintmike, KhorneFlakez, kingjohn, BigBlackBic. Settings: map: multiplayer_Paths_of_Daggers era: era_default XP: 40 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 00:22:24< dicplobby> 20120326 00:22:24 Statistics: number_of_games = 1 number_of_users = 2 lobby_users = 0 20120326 00:22:25< lobby> 20120326 00:22:25 Statistics: number_of_games = 44 number_of_users = 157 lobby_users = 36 20120326 00:22:40< lobby> DukeDaniel ended game: "DukeDaniel’s game" (7884) at turn: 30 with reason: 'game over'. (socket: 12082) 20120326 00:23:35< lobby> Tobain ended game: "ithaxa’s game" (8176) at turn: 8 with reason: 'out of sync'. (socket: 12527) 20120326 00:24:43< lobby> morde ended game: "morde’s game" (8167) at turn: 20 with reason: 'game over'. (socket: 12513) 20120326 00:25:05< tuxlobby> 20120326 00:25:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 00:25:13< lobby> Trigramatic ended game: "bluewolf27’s game" (8168) at turn: 26 with reason: 'game over'. (socket: 12497) 20120326 00:25:18< lobby> ilikeblue949 ended game: "ilikeblue949’s game" (8213) at turn: 3 with reason: 'aborted'. (socket: 12536) 20120326 00:25:49< lobby> ilikeblue949 started game: "ilikeblue949’s game" (8220) with: ilikeblue949. Settings: map: SXC_Stronghold_0.2.98 era: Ageless Heroes XP: 130 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 00:26:33< lobby> Tuor12 ended game: "Jeu de Laear" (8175) at turn: 17 with reason: 'game over'. (socket: 12367) 20120326 00:26:54< lobby> Ideathy ended game: "Braineel’s game" (8062) at turn: 5 with reason: 'game over'. (socket: 12350) 20120326 00:27:04< lobby> bluewolf27 started game: "bluewolf27’s game" (8225) with: bluewolf27, Trigramatic, MsEdyn. Settings: map: multiplayer_3p_Morituri era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 00:27:24< dicplobby> 20120326 00:27:24 Statistics: number_of_games = 1 number_of_users = 2 lobby_users = 0 20120326 00:27:25< lobby> 20120326 00:27:25 Statistics: number_of_games = 44 number_of_users = 158 lobby_users = 37 20120326 00:27:43< lobby> Hanswuerstchen ended game: "Jointas Partie" (8214) at turn: 43 with reason: 'game over'. (socket: 12345) 20120326 00:28:25< lobby> Laear started game: "Jeu de Laear" (8226) with: Laear, Tuor12. Settings: map: multiplayer_Clash era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 00:28:43< lobby> Velociraptor ended game: "La partida de Velociraptor" (8120) at turn: 33 with reason: 'aborted'. (socket: 12432) 20120326 00:29:28< lobby> Attenpeter ended game: "Kr0Noss Partie" (8115) at turn: 27 with reason: 'game over'. (socket: 12328) 20120326 00:29:50< lobby> Braineel started game: "Braineel’s game" (8223) with: Braineel, HardRevenge, Ideathy. Settings: map: TGQ_Scenario2_Sand era: TGQ_era XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 00:30:05< tuxlobby> 20120326 00:30:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 00:30:33< lobby> Trenton started game: "ian is a nub" (8227) with: Trenton, blobbytheblob. Settings: map: multiplayer_4p_Underworld era: 1Infection XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 00:31:20< lobby> wrypage started game: "wrypage’s game" (8230) with: wrypage, thekrep. Settings: map: multiplayer_Waterloo_Sunset era: era_heroes XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 00:31:38< lobby> Danniel_BR ended game: "nome de Danniel_BR" (8208) at turn: 4 with reason: 'aborted' and disconnected. (socket: 12461) 20120326 00:31:51< lobby> <-Gomes-BR-> vo da reload 20120326 00:32:17< lobby> -Gomes-BR- started game: "nome de -Gomes-BR-" (8233) with: -Gomes-BR-, Danniel_BR, BR_Scotta, LuizBR. Settings: map: multiplayer_Isars_Cross era: era_default XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 00:32:24< dicplobby> 20120326 00:32:24 Statistics: number_of_games = 1 number_of_users = 2 lobby_users = 0 20120326 00:32:28< lobby> 20120326 00:32:28 Statistics: number_of_games = 45 number_of_users = 162 lobby_users = 34 20120326 00:32:42< lobby> Grezdaed started game: "Grezdaed’s game" (8234) with: Grezdaed, Orathoy. Settings: map: CSABI_The_Valley_of_the_Fear era: era_default XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 00:32:46< lobby> Bombur started game: "Bombur’s game" (8232) with: Bombur, cptn_cool. Settings: map: multiplayer_Siege_Castles era: era_heroes XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 00:32:56< lobby> Grezdaed ended game: "Grezdaed’s game" (8234) at turn: 1 with reason: 'aborted'. (socket: 12626) 20120326 00:33:03< lobby> noob-killer started game: "noob-killer’s Deathmatch ^^" (8231) with: noob-killer, CrazyPotato, o_0. Settings: map: 3p_3p_dark_blood_traingle_dm era: Colosseum_era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 00:33:04< lobby> cptn_cool ended game: "Bombur’s game" (8232) at turn: 1 with reason: 'aborted'. (socket: 12635) 20120326 00:33:21< lobby> Grezdaed started game: "Grezdaed’s game" (8236) with: Grezdaed, Orathoy. Settings: map: CSABI_The_Valley_of_the_Fear era: era_default XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 00:33:31< lobby> ilikeblue949 ended game: "ilikeblue949’s game" (8220) at turn: 5 with reason: 'aborted'. (socket: 12536) 20120326 00:33:32< lobby> Grezdaed ended game: "Grezdaed’s game" (8236) at turn: 1 with reason: 'aborted'. (socket: 12626) 20120326 00:34:11< lobby> Grezdaed started game: "Grezdaed’s game" (8238) with: Grezdaed, Orathoy. Settings: map: CSABI_The_Prison era: era_default XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 00:34:16< lobby> Grezdaed ended game: "Grezdaed’s game" (8238) at turn: 51 with reason: 'aborted'. (socket: 12626) 20120326 00:34:38< lobby> essor started game: "with 60 sec timer 2 vs 2" (8222) with: essor, nic, zumbies. Settings: map: Creep War v0.2.11.1 era: Creep_Era_v0.2.11.1 XP: 60 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 00:34:58< lobby> Grezdaed started game: "Grezdaed’s game" (8239) with: Grezdaed, Orathoy. Settings: map: CSABI_The_Valley_of_the_Fear era: era_default XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 00:35:05< tuxlobby> 20120326 00:35:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 00:35:06< lobby> Grezdaed ended game: "Grezdaed’s game" (8239) at turn: 1 with reason: 'aborted'. (socket: 12626) 20120326 00:35:20< lobby> Seacet started game: "nome de Seacet" (8219) with: Seacet, ithaxa, Tobain, Elsarin2. Settings: map: SXC_Light_Cave_0.2.98 era: Ageless RPG Era XP: 130 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 00:36:10< lobby> Grezdaed started game: "Grezdaed’s game" (8240) with: Grezdaed, Orathoy. Settings: map: CSABI_The_Prison era: era_default XP: 100 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 00:36:46< lobby> Grezdaed ended game: "Grezdaed’s game" (8240) at turn: 1 with reason: 'aborted'. (socket: 12626) 20120326 00:37:23< lobby> Sh1k4m4ru ended game: "Malik_Was_Here’s game" (8059) at turn: 36 with reason: 'out of sync'. (socket: 12604) 20120326 00:37:24< dicplobby> 20120326 00:37:24 Statistics: number_of_games = 1 number_of_users = 2 lobby_users = 0 20120326 00:37:28< lobby> 20120326 00:37:28 Statistics: number_of_games = 44 number_of_users = 156 lobby_users = 33 20120326 00:37:52< lobby> Grezdaed started game: "Grezdaed’s game" (8243) with: Grezdaed, Orathoy. Settings: map: CSABI_The_Valley_of_the_Fear era: era_default XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 00:38:59< lobby> blobbytheblob ended game: "ian is a nub" (8227) at turn: 4 with reason: 'aborted'. (socket: 12629) 20120326 00:39:06< lobby> KalenzZ ended game: "Jeu de KalenzZ" (7976) at turn: 30 with reason: 'game over'. (socket: 10980) 20120326 00:39:09< lobby> Kitoshide started game: "Kitoshide’s game" (8217) with: Kitoshide, ViralFerret, TheCultHero. Settings: map: Colosseum_scenario era: Ageless Era XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 00:39:36< lobby> ilikeblue949 started game: "ilikeblue949’s game" (8237) with: ilikeblue949, Regalr. Settings: map: SXC_Stronghold_0.2.98 era: Ageless Heroes XP: 130 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 00:40:05< tuxlobby> 20120326 00:40:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 00:40:24< lobby> Trenton started game: "ian is a nub" (8245) with: Trenton, blobbytheblob. Settings: map: multiplayer_4p_Underworld era: 1Infection XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 00:40:54< lobby> Roger ended game: "Era of High Sorcery, FFA" (8207) at turn: 6 with reason: 'aborted'. (socket: 12271) 20120326 00:40:57< lobby> Pagan advanced game: "WC_NM Hardcore - reserved" (7997) with: Pagan, plk2. Settings: map: TL_WC_NM_Island2 era: XP: 80 GPV: fog: shroud: observers: shuffle: timer: 20120326 00:41:52< lobby> KalenzZ started game: "Jeu de KalenzZ" (8246) with: KalenzZ. Settings: map: CSABI_Leaving_the_Island era: Ageless Era XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 00:42:24< dicplobby> 20120326 00:42:24 Statistics: number_of_games = 1 number_of_users = 2 lobby_users = 0 20120326 00:42:28< lobby> 20120326 00:42:28 Statistics: number_of_games = 47 number_of_users = 157 lobby_users = 37 20120326 00:42:39< lobby> KalenzZ ended game: "Jeu de KalenzZ" (8246) at turn: 13 with reason: 'aborted'. (socket: 10980) 20120326 00:43:12< lobby> Kalyra started game: "La partida de Kalyra" (8249) with: Kalyra, Roger, Stenen_, Wedge. Settings: map: multiplayer_4p_Hamlets era: Dov_XP_Mod XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 00:43:47< lobby> Pagan ended game: "WC_NM Hardcore - reserved" (7997) at turn: 1 with reason: 'game over'. (socket: 12003) 20120326 00:44:07< lobby> KalenzZ started game: "Jeu de KalenzZ" (8250) with: KalenzZ. Settings: map: SXRPG TheEvilDead era: Ageless RPG Era XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 00:44:20< lobby> gdn ended game: "all random" (8131) at turn: 39 with reason: 'aborted'. (socket: 12389) 20120326 00:45:05< tuxlobby> 20120326 00:45:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 00:46:11< lobby> girwasx ended game: "Lucaness’s game" (8203) at turn: 18 with reason: 'game over'. (socket: 12573) 20120326 00:46:42< lobby> HardRevenge ended game: "Braineel’s game" (8223) at turn: 5 with reason: 'aborted' and disconnected. (socket: 12621) 20120326 00:46:48< lobby> Malik_Was_Here started game: "Malik_Was_Here’s game" (8242) with: Malik_Was_Here, Sh1k4m4ru, joebob. Settings: map: Colosseum_scenario era: Colosseum_Extended_era XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 00:46:54< lobby> prasmal ended game: "Gra użytkownika prasmal" (8139) at turn: 22 with reason: 'aborted'. (socket: 12402) 20120326 00:47:07< lobby> gargant ended game: "Survival 3 p" (8106) at turn: 29 with reason: 'game over'. (socket: 12334) 20120326 00:47:07< lobby> prasmal started game: "Gra użytkownika prasmal" (8252) with: prasmal. Settings: map: isars_blasphemy era: era_default XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 00:47:25< dicplobby> 20120326 00:47:24 Statistics: number_of_games = 1 number_of_users = 2 lobby_users = 0 20120326 00:47:26< lobby> FiMiAM ended game: "Игра Panfil-Ugly" (7869) at turn: 44 with reason: 'game over'. (socket: 11496) 20120326 00:47:28< lobby> 20120326 00:47:28 Statistics: number_of_games = 42 number_of_users = 151 lobby_users = 34 20120326 00:48:25< lobby> ilikeblue949 started game: "ilikeblue949’s game" (8247) with: ilikeblue949, wof. Settings: map: SXC_Stronghold_0.2.98 era: Ageless Heroes XP: 130 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 00:48:36< lobby> Gregor started game: "Era of High Sorcery, reserved Isorak" (8254) with: Gregor, Isorak. Settings: map: multiplayer_Weldyn_Channel era: era_of_high_sorcery XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 00:48:47< lobby> Minion ended game: "Minion’s game" (8191) at turn: 24 with reason: 'game over'. (socket: 12539) 20120326 00:49:33< lobby> prasmal ended game: "Gra użytkownika prasmal" (8252) at turn: 23 with reason: 'aborted'. (socket: 12402) 20120326 00:49:37< lobby> Hope started game: "Survival 3/2players" (8256) with: Hope, 187, Diasporoz. Settings: map: ice era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 00:49:43< lobby> prasmal started game: "Gra użytkownika prasmal" (8258) with: prasmal. Settings: map: isars_blasphemy era: era_default XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 00:49:46< lobby> maehlager ended game: "IloSophieps Partie" (8165) at turn: 14 with reason: 'aborted'. (socket: 12508) 20120326 00:49:48< lobby> Megamuffins started game: "Megamuffins’s game" (8257) with: Megamuffins, Lucaness. Settings: map: multiplayer_Random_Map era: era_default XP: 100 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 00:50:05< tuxlobby> 20120326 00:50:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 00:50:36< lobby> KalenzZ ended game: "Jeu de KalenzZ" (8250) at turn: 23 with reason: 'aborted'. (socket: 10980) 20120326 00:50:54< lobby> prasmal ended game: "Gra użytkownika prasmal" (8258) at turn: 23 with reason: 'aborted'. (socket: 12402) 20120326 00:51:05< lobby> prasmal started game: "Gra użytkownika prasmal" (8261) with: prasmal. Settings: map: isars_blasphemy era: era_default XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 00:51:09< lobby> KalenzZ started game: "Jeu de KalenzZ" (8260) with: KalenzZ. Settings: map: SXRPG TheEvilDead era: Ageless RPG Era XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 00:51:15< lobby> dmr started game: "dmr’s game" (8259) with: dmr, eric235u. Settings: map: multiplayer_Hamlets era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 00:52:24< dicplobby> 20120326 00:52:24 Statistics: number_of_games = 1 number_of_users = 2 lobby_users = 0 20120326 00:52:28< lobby> 20120326 00:52:28 Statistics: number_of_games = 43 number_of_users = 147 lobby_users = 29 20120326 00:52:37< lobby> kurono started game: "La partida de kurono" (8263) with: kurono. Settings: map: multiplayer_2p_Dark_Forecast era: era_EOM_5.10.0 svn XP: 90 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 00:53:53< lobby> prasmal ended game: "Gra użytkownika prasmal" (8261) at turn: 24 with reason: 'aborted'. (socket: 12402) 20120326 00:54:02< lobby> prasmal started game: "Gra użytkownika prasmal" (8265) with: prasmal. Settings: map: isars_blasphemy era: era_default XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 00:54:13< lobby> wof ended game: "ilikeblue949’s game" (8247) at turn: 3 with reason: 'aborted'. (socket: 12656) 20120326 00:54:19< lobby> Regalr ended game: "ilikeblue949’s game" (8237) at turn: 1 with reason: 'aborted'. (socket: 11697) 20120326 00:54:45< lobby> Minion started game: "Minion’s game" (8264) with: Minion, Regalr. Settings: map: prison_break era: Ageless Era XP: 60 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 00:54:49< lobby> Diasporoz ended game: "Survival 3/2players" (8256) at turn: 3 with reason: 'aborted'. (socket: 12663) 20120326 00:54:56< lobby> legolaskiller started game: "legolaskiller’s game" (8267) with: legolaskiller. Settings: map: user_map era: era_arma_standard XP: 30 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 00:55:05< tuxlobby> 20120326 00:55:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 00:55:38< lobby> Atasco started game: "Atasco’s game" (8262) with: Atasco, Nephrite, ShadowVeil, Danniel_BR. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 00:56:39< lobby> prasmal ended game: "Gra użytkownika prasmal" (8265) at turn: 24 with reason: 'aborted'. (socket: 12402) 20120326 00:56:49< lobby> prasmal started game: "Gra użytkownika prasmal" (8270) with: prasmal. Settings: map: isars_blasphemy era: era_default XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 00:56:55< lobby> prasmal ended game: "Gra użytkownika prasmal" (8270) at turn: 24 with reason: 'aborted'. (socket: 12402) 20120326 00:57:00< lobby> kurono ended game: "La partida de kurono" (8263) at turn: 3 with reason: 'aborted'. (socket: 12666) 20120326 00:57:05< lobby> prasmal started game: "Gra użytkownika prasmal" (8272) with: prasmal. Settings: map: isars_blasphemy era: era_default XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 00:57:24< dicplobby> 20120326 00:57:24 Statistics: number_of_games = 1 number_of_users = 2 lobby_users = 0 20120326 00:57:28< lobby> 20120326 00:57:28 Statistics: number_of_games = 46 number_of_users = 148 lobby_users = 28 20120326 00:57:47< lobby> Diasporoz started game: "reserved" (8271) with: Diasporoz, 187. Settings: map: prison_break era: Dov_XP_Mod XP: 60 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 00:58:18< lobby> KalenzZ ended game: "Jeu de KalenzZ" (8260) at turn: 24 with reason: 'aborted'. (socket: 10980) 20120326 00:58:18< lobby> ilikeblue949 started game: "ilikeblue949’s game" (8266) with: ilikeblue949, wof. Settings: map: SXC_Stronghold_0.2.98 era: Ageless Heroes XP: 130 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 00:59:04< lobby> kurono started game: "La partida de kurono" (8277) with: kurono. Settings: map: multiplayer_2p_Dark_Forecast era: aoh_nightmares_of_meloen_1.0.2 svn XP: 90 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 00:59:06< lobby> KalenzZ started game: "Jeu de KalenzZ" (8278) with: KalenzZ. Settings: map: SXRPG TheEvilDead era: Ageless RPG Era XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 00:59:06< lobby> KalenzZ ended game: "Jeu de KalenzZ" (8278) at turn: 24 with reason: 'aborted'. (socket: 10980) 20120326 00:59:19< lobby> legolaskiller ended game: "legolaskiller’s game" (8267) at turn: 8 with reason: 'game over'. (socket: 12669) 20120326 00:59:33< lobby> KalenzZ started game: "Jeu de KalenzZ" (8280) with: KalenzZ. Settings: map: SXRPG TheEvilDead era: Ageless RPG Era XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 00:59:34< lobby> KalenzZ ended game: "Jeu de KalenzZ" (8280) at turn: 23 with reason: 'aborted'. (socket: 10980) 20120326 00:59:35< lobby> kicio17 started game: "kicio17’s game" (8269) with: kicio17, floppyman227, hambergerman227. Settings: map: TT_02_the_castle era: era_default XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 00:59:46< lobby> Malik_Was_Here ended game: "Malik_Was_Here’s game" (8242) at turn: 39 with reason: 'game over'. (socket: 11888) 20120326 00:59:47< lobby> Creon started game: "Creon’s game" (8279) with: Creon, Zinnsoldat. Settings: map: RBY Weldyn Channel 12 era: RBY No Mirror XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 00:59:51< lobby> noob-killer ended game: "noob-killer’s Deathmatch ^^" (8231) at turn: 37 with reason: 'game over'. (socket: 12625) 20120326 01:00:03< lobby> ^^ 20120326 01:00:05< tuxlobby> 20120326 01:00:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 01:00:37< lobby> KalenzZ started game: "Jeu de KalenzZ" (8281) with: KalenzZ. Settings: map: SXRPG TheEvilDead era: Ageless RPG Era XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 01:01:25< lobby> zulu started game: "1 vs 1, 3 heros each, RANDOM, 1 min per turn" (8282) with: zulu, derpderpderp. Settings: map: Creep War New Map v0.2.11.1 era: Creep_Era_v0.2.11.1 XP: 60 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 01:01:34< lobby> Mostovoi13 ended game: "ChrisH’s game" (8200) at turn: 6 with reason: 'aborted'. (socket: 12576) 20120326 01:01:57< lobby> ilikeblue949 ended game: "ilikeblue949’s game" (8266) at turn: 2 with reason: 'aborted'. (socket: 12536) 20120326 01:01:57< lobby> BR_Scotta ended game: "nome de -Gomes-BR-" (8233) at turn: 7 with reason: 'aborted'. (socket: 12509) 20120326 01:02:03< lobby> sx tu nao gosta né gomes ? 20120326 01:02:06< lobby> <-Gomes-BR-> vamo jogar o que 20120326 01:02:14< lobby> <-Gomes-BR-> eu gosto mas num tenho as eras 20120326 01:02:17< lobby> perae 20120326 01:02:23< lobby> Hope started game: "Survival" (8284) with: Hope, deepak, Sioux. Settings: map: ice era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 01:02:24< dicplobby> 20120326 01:02:24 Statistics: number_of_games = 1 number_of_users = 2 lobby_users = 0 20120326 01:02:28< lobby> jogamo na era normal 20120326 01:02:34< lobby> <-Gomes-BR-> ok 20120326 01:02:35< lobby> se bem q fica podre, ngm vai entrar 20120326 01:02:37< lobby> 20120326 01:02:37 Statistics: number_of_games = 44 number_of_users = 150 lobby_users = 37 20120326 01:02:39< lobby> hehee 20120326 01:02:58< lobby> <-Gomes-BR-> so nois XD 20120326 01:03:06< lobby> bora outra rapidinha? 20120326 01:03:10< lobby> <-Gomes-BR-> mé mais tri 20120326 01:03:24< lobby> <-Gomes-BR-> qual? 20120326 01:03:37< lobby> prometo não fazer besteira dessa vez, vou jogar sério 20120326 01:03:43< lobby> <-Gomes-BR-> hsuahusha 20120326 01:03:46< lobby> Maru ended game: "Marus Partie" (8049) at turn: 20 with reason: 'game over'. (socket: 12305) 20120326 01:03:47< lobby> 2x2 mesmo 20120326 01:03:51< lobby> <-Gomes-BR-> ok 20120326 01:03:53< lobby> <-Gomes-BR-> kem cria? 20120326 01:03:54< lobby> q tal confronto? 20120326 01:04:01< lobby> <-Gomes-BR-> pode ser 20120326 01:04:11< lobby> 1x1x1 ? 20120326 01:04:15< lobby> posso criar? 20120326 01:04:20< lobby> <-Gomes-BR-> cria ai 20120326 01:04:20< lobby> kurono ended game: "La partida de kurono" (8277) at turn: 6 with reason: 'aborted'. (socket: 12666) 20120326 01:04:29< lobby> é isso ? 20120326 01:05:05< tuxlobby> 20120326 01:05:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 01:05:10< lobby> ChrisH started game: "ChrisH’s game" (8287) with: ChrisH, o_0, Hakun, Mostovoi13. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 01:05:28< lobby> BR_Scotta started game: "nome de BR_Scotta" (8289) with: BR_Scotta, -Gomes-BR-, LuizBR, adun. Settings: map: multiplayer_Clash era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 01:05:59< lobby> EpicFailGuy started game: "EpicFailGuys Partie" (8290) with: EpicFailGuy. Settings: map: Colosseum_scenario era: Colosseum_Extended_era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 01:06:21< lobby> legolaskiller started game: "legolaskiller’s game" (8283) with: legolaskiller, Legolas95. Settings: map: user_map era: era_arma_standard XP: 30 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 01:06:28< lobby> EpicFailGuy ended game: "EpicFailGuys Partie" (8290) at turn: 1 with reason: 'aborted'. (socket: 12698) 20120326 01:07:03< lobby> 20120326 01:07:08< lobby> prasmal ended game: "Gra użytkownika prasmal" (8272) at turn: 30 with reason: 'aborted'. (socket: 12402) 20120326 01:07:17< lobby> prasmal started game: "Gra użytkownika prasmal" (8293) with: prasmal. Settings: map: isars_blasphemy era: era_default XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 01:07:24< dicplobby> 20120326 01:07:24 Statistics: number_of_games = 1 number_of_users = 2 lobby_users = 0 20120326 01:07:34< lobby> carlangas started game: "carlangas’s game" (8294) with: carlangas, kurono. Settings: map: multiplayer_2p_Dark_Forecast era: era_default XP: 100 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 01:07:37< lobby> 20120326 01:07:37 Statistics: number_of_games = 46 number_of_users = 152 lobby_users = 31 20120326 01:07:55< lobby> prasmal ended game: "Gra użytkownika prasmal" (8293) at turn: 30 with reason: 'aborted'. (socket: 12402) 20120326 01:07:56< lobby> kurono ended game: "carlangas’s game" (8294) at turn: 1 with reason: 'aborted'. (socket: 12666) 20120326 01:07:56< lobby> noob-killer started game: "noob-killer’s game test Ageless" (8295) with: noob-killer. Settings: map: isars_blasphemy era: Ageless Era XP: 60 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 01:08:04< lobby> prasmal started game: "Gra użytkownika prasmal" (8298) with: prasmal. Settings: map: isars_blasphemy era: era_default XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 01:08:26< lobby> carlangas started game: "carlangas’s game" (8297) with: carlangas, kurono. Settings: map: multiplayer_2p_Dark_Forecast era: era_default XP: 100 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 01:08:49< lobby> Flapjacks ended game: "Anibal’s game" (8190) at turn: 14 with reason: 'game over'. (socket: 12550) 20120326 01:09:14< lobby> Inteliteknia ended game: "Free 4 All" (8093) at turn: 25 with reason: 'game over'. (socket: 12368) 20120326 01:09:25< lobby> addfriend FebrezeBrother 20120326 01:09:34< lobby> EpicFailGuy started game: "EpicFailGuys Partie" (8300) with: EpicFailGuy. Settings: map: Colosseum_scenario era: Colosseum_Extended_era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 01:10:06< tuxlobby> 20120326 01:10:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 01:10:51< lobby> Trenton ended game: "ian is a nub" (8245) at turn: 6 with reason: 'aborted' and disconnected. (socket: 12613) 20120326 01:12:04< lobby> adun started game: "adun’s game" (8301) with: adun, Hoodlum, ilikeblue949, I5YKA. Settings: map: multiplayer_4p_Underworld era: era_heroes XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 01:12:25< dicplobby> 20120326 01:12:24 Statistics: number_of_games = 1 number_of_users = 2 lobby_users = 0 20120326 01:12:37< lobby> 20120326 01:12:37 Statistics: number_of_games = 45 number_of_users = 154 lobby_users = 32 20120326 01:13:17< lobby> dmr ended game: "dmr’s game" (8259) at turn: 8 with reason: 'game over'. (socket: 12657) 20120326 01:13:29-!- Johannes13 [~Johannes@unaffiliated/johannes13] has quit [Ping timeout: 252 seconds] 20120326 01:14:15< lobby> Anibal started game: "Anibal’s game" (8302) with: Anibal, Flapjacks, Krulor, artase. Settings: map: multiplayer_Clash era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 01:14:47< lobby> dmr started game: "dmr’s game" (8303) with: dmr, eric235u. Settings: map: multiplayer_Clash era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 01:14:54< lobby> Diasporoz ended game: "reserved" (8271) at turn: 9 with reason: 'game over'. (socket: 12663) 20120326 01:15:03< lobby> TheVeneGuy ended game: "TwistedClock’s game" (8194) at turn: 16 with reason: 'game over'. (socket: 12491) 20120326 01:15:06< tuxlobby> 20120326 01:15:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 01:16:22< lobby> goldfrog ended game: "random" (8181) at turn: 18 with reason: 'game over'. (socket: 12540) 20120326 01:16:27< lobby> kicio17 ended game: "kicio17’s game" (8269) at turn: 12 with reason: 'game over'. (socket: 12675) 20120326 01:16:51< lobby> kicio17 started game: "kicio17’s game" (8307) with: kicio17, floppyman227, hambergerman227. Settings: map: TT_02_the_castle era: era_default XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 01:16:56< lobby> KalenzZ ended game: "Jeu de KalenzZ" (8281) at turn: 29 with reason: 'aborted'. (socket: 10980) 20120326 01:17:07< lobby> KimmyNL ended game: "JayEnfield’s game" (8212) at turn: 22 with reason: 'game over'. (socket: 12587) 20120326 01:17:13< lobby> erm 20120326 01:17:24< dicplobby> 20120326 01:17:24 Statistics: number_of_games = 1 number_of_users = 2 lobby_users = 0 20120326 01:17:48< lobby> KalenzZ started game: "Jeu de KalenzZ" (8308) with: KalenzZ. Settings: map: SXRPG TheEvilDead era: Ageless RPG Era XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 01:18:00< lobby> 20120326 01:18:00 Statistics: number_of_games = 42 number_of_users = 152 lobby_users = 33 20120326 01:18:20< lobby> Trav_is_good started game: "Trav_is_good’s game" (8305) with: Trav_is_good, goldfrog, jenny. Settings: map: Dov_MP_Orocia era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 01:20:05< tuxlobby> 20120326 01:20:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 01:20:07< lobby> 187 started game: "187’s game" (8310) with: 187, Diasporoz. Settings: map: prison_break era: Dov_XP_Mod XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 01:20:09< lobby> jveino ended game: "jveino’s game" (8179) at turn: 11 with reason: 'aborted' and disconnected. (socket: 12531) 20120326 01:20:17< lobby> hambergerman227 ended game: "kicio17’s game" (8307) at turn: 11 with reason: 'aborted'. (socket: 12681) 20120326 01:20:38< lobby> Diasporoz ended game: "187’s game" (8310) at turn: 8 with reason: 'aborted'. (socket: 12722) 20120326 01:20:45< dicplobby> cartman has logged off. (socket: 57) 20120326 01:20:47< dicplobby> laycastle ended game: "Battaglia di cartman" (25) at turn: 20 with reason: 'aborted'. (socket: 58) 20120326 01:20:50< dicplobby> laycastle has logged off. (socket: 58) 20120326 01:21:23< lobby> 187 started game: "187’s game" (8313) with: 187, Diasporoz. Settings: map: prison_break era: Dov_XP_Mod XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 01:22:24< dicplobby> 20120326 01:22:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 01:23:00< lobby> 20120326 01:23:00 Statistics: number_of_games = 44 number_of_users = 147 lobby_users = 27 20120326 01:23:49< lobby> Lucaness ended game: "Megamuffins’s game" (8257) at turn: 13 with reason: 'aborted'. (socket: 12063) 20120326 01:24:10< lobby> Limon started game: "nome de Limon" (8314) with: Limon. Settings: map: Colosseum_scenario era: Ageless RPG Era XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 01:24:11< lobby> noob-killer ended game: "noob-killer’s game test Ageless" (8295) at turn: 16 with reason: 'game over'. (socket: 12625) 20120326 01:24:37< lobby> noob-killer started game: "noob-killer’s game" (8315) with: noob-killer. Settings: map: isars_blasphemy era: Ageless Era XP: 60 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 01:25:05< tuxlobby> 20120326 01:25:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 01:25:25< lobby> Tanorik started game: "Tanorik’s game" (8316) with: Tanorik. Settings: map: multiplayer_The_Freelands era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 01:26:04< lobby> DeadlyGrim started game: "Fast game : P - without same units at start :P." (8309) with: DeadlyGrim, UT_MWKICH, nielsen1. Settings: map: SXC_Attack_0.2.98 era: sxc_default_low_level_era XP: 130 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 01:27:24< dicplobby> 20120326 01:27:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 01:28:00< lobby> 20120326 01:28:00 Statistics: number_of_games = 44 number_of_users = 150 lobby_users = 34 20120326 01:29:59< lobby> noob-killer ended game: "noob-killer’s game" (8315) at turn: 7 with reason: 'aborted'. (socket: 12625) 20120326 01:30:05< tuxlobby> 20120326 01:30:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 01:30:21< lobby> Malthu started game: "Malthu’s game" (8317) with: Malthu. Settings: map: multiplayer_Clash era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 01:31:30< lobby> noob-killer started game: "noob-killer’s game" (8319) with: noob-killer. Settings: map: isars_blasphemy era: Ageless Era XP: 60 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 01:31:48< lobby> Isorak ended game: "Era of High Sorcery, reserved Isorak" (8254) at turn: 12 with reason: 'game over'. (socket: 12515) 20120326 01:32:23< lobby> MsEdyn ended game: "bluewolf27’s game" (8225) at turn: 19 with reason: 'game over'. (socket: 12528) 20120326 01:32:24< dicplobby> 20120326 01:32:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 01:32:31< lobby> Tuor12 ended game: "Jeu de Laear" (8226) at turn: 22 with reason: 'game over'. (socket: 12367) 20120326 01:32:35< lobby> Schafan ended game: "Dasztos Dampfkessel" (8009) at turn: 123 with reason: 'aborted'. (socket: 12242) 20120326 01:33:02< lobby> 20120326 01:33:02 Statistics: number_of_games = 42 number_of_users = 147 lobby_users = 34 20120326 01:34:00< lobby> noob-killer ended game: "noob-killer’s game" (8319) at turn: 3 with reason: 'aborted'. (socket: 12625) 20120326 01:34:55< lobby> prasmal ended game: "Gra użytkownika prasmal" (8298) at turn: 40 with reason: 'aborted'. (socket: 12402) 20120326 01:34:55< lobby> Irmao-Verdade ended game: "1 vs 1 . 2 sides each player" (8205) at turn: 11 with reason: 'game over'. (socket: 12572) 20120326 01:35:05< tuxlobby> 20120326 01:35:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 01:35:51< lobby> meganoob ended game: "Tatiana’s game" (7913) at turn: 26 with reason: 'aborted'. (socket: 12129) 20120326 01:36:02< lobby> Tanorik ended game: "Tanorik’s game" (8316) at turn: 12 with reason: 'aborted'. (socket: 12686) 20120326 01:36:10< lobby> universe ended game: "Ultron_Lives’s game" (8121) at turn: 21 with reason: 'game over'. (socket: 12077) 20120326 01:37:00< lobby> largefood started game: "largefood’s game" (8325) with: largefood. Settings: map: user_map era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 01:37:25< dicplobby> 20120326 01:37:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 01:37:49< lobby> Creon ended game: "Creon’s game" (8279) at turn: 14 with reason: 'aborted'. (socket: 12644) 20120326 01:38:02< lobby> 20120326 01:38:02 Statistics: number_of_games = 40 number_of_users = 143 lobby_users = 39 20120326 01:38:12< lobby> Random_Man92 started game: "Random_Man92’s game" (8328) with: Random_Man92, Tanorik. Settings: map: multiplayer_Volcano era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 01:38:13< lobby> Limon ended game: "nome de Limon" (8314) at turn: 21 with reason: 'aborted'. (socket: 12677) 20120326 01:38:15< lobby> Haugen1992 started game: "Haugen1992’s game" (8329) with: Haugen1992, McGalisto. Settings: map: user_map era: era_heroes XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 01:38:30< lobby> Creon started game: "Creon’s game" (8330) with: Creon, Zinnsoldat. Settings: map: RBY Den Of Onis 12 era: RBY No Mirror XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 01:38:36< lobby> largefood ended game: "largefood’s game" (8325) at turn: 2 with reason: 'aborted'. (socket: 12693) 20120326 01:39:01< lobby> deepak ended game: "Survival" (8284) at turn: 14 with reason: 'aborted'. (socket: 12683) 20120326 01:39:08< lobby> Tanorik ended game: "Random_Man92’s game" (8328) at turn: 1 with reason: 'aborted'. (socket: 12686) 20120326 01:39:46< lobby> Jojolaffreux started game: "Jeu de Jojolaffreux" (8327) with: Jojolaffreux, Eruadan, SKS, deepak. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 01:40:05< tuxlobby> 20120326 01:40:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 01:40:23< lobby> Random_Man92 started game: "Random_Man92’s game" (8332) with: Random_Man92, Tanorik. Settings: map: multiplayer_Volcano era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 01:40:32< lobby> Ivan_D started game: "MOD MODE" (8323) with: Ivan_D, hiu, ksz. Settings: map: SXC_Advanced_0.2.98 era: sxc_default_low_level_era XP: 130 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 01:41:28< lobby> Wagolita started game: "Party platter by Druten " (8331) with: Wagolita, Beanbarian. Settings: map: user_map era: era_default XP: 40 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 01:41:55< lobby> Diasporoz ended game: "187’s game" (8313) at turn: 14 with reason: 'aborted'. (socket: 12722) 20120326 01:42:24< dicplobby> 20120326 01:42:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 01:43:02< lobby> 20120326 01:43:02 Statistics: number_of_games = 42 number_of_users = 148 lobby_users = 40 20120326 01:43:34< lobby> FebrezeBrother started game: "FebrezeBrother’s game" (8320) with: FebrezeBrother, Tongue, Magnesia, ZyklonA. Settings: map: multiplayer_4p_Hamlets era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 01:44:40< lobby> xivarmy started game: "xivarmy’s game" (8339) with: xivarmy, OD. Settings: map: multiplayer_Silverhead_Crossing era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 01:45:01< lobby> Mostovoi13 ended game: "ChrisH’s game" (8287) at turn: 9 with reason: 'aborted'. (socket: 12576) 20120326 01:45:05< tuxlobby> 20120326 01:45:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 01:45:13< lobby> Orathoy ended game: "Grezdaed’s game" (8243) at turn: 12 with reason: 'aborted'. (socket: 12647) 20120326 01:45:32< lobby> ChrisH started game: "ChrisH’s game" (8338) with: ChrisH, Hakun, jhcordeiro, SilvrDrakon. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 01:45:44< lobby> cptn_cool started game: "cptn_cool’s game" (8341) with: cptn_cool, Bombur. Settings: map: multiplayer_Waterloo_Sunset era: era_heroes XP: 50 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 01:45:59< lobby> Grezdaed started game: "Grezdaed’s game" (8343) with: Grezdaed, Orathoy. Settings: map: CSABI_The_Prison era: era_default XP: 100 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 01:46:36< lobby> MsEdyn started game: "MsEdyn’s game" (8344) with: MsEdyn. Settings: map: multiplayer_2p_Dark_Forecast era: era_default XP: 100 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 01:46:36< lobby> Kira1 ended game: "ladder for Shagal" (8185) at turn: 19 with reason: 'game over'. (socket: 12437) 20120326 01:46:48< lobby> cptn_cool ended game: "cptn_cool’s game" (8341) at turn: 1 with reason: 'aborted'. (socket: 12764) 20120326 01:47:24< dicplobby> 20120326 01:47:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 01:47:46< lobby> ShadowVeil ended game: "Atasco’s game" (8262) at turn: 11 with reason: 'aborted'. (socket: 12667) 20120326 01:47:52< lobby> cptn_cool started game: "cptn_cool’s game" (8347) with: cptn_cool, Bombur. Settings: map: multiplayer_Waterloo_Sunset era: era_heroes XP: 50 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 01:48:04< lobby> 20120326 01:48:04 Statistics: number_of_games = 41 number_of_users = 150 lobby_users = 48 20120326 01:48:12< dicplobby> pylou has logged on. (socket: 59) 20120326 01:48:15< dicplobby> pylou has logged off. (socket: 59) 20120326 01:48:29< lobby> Atasco started game: "2on2 isars" (8349) with: Atasco, Zwirni, Nephrite, Diasporoz. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 01:49:59< lobby> ZachAttack started game: "ZachAttack’s game" (8337) with: ZachAttack, lulubell. Settings: map: user_map era: GLEE XP: 50 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 01:50:05< tuxlobby> 20120326 01:50:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 01:50:29< lobby> Gretik started game: "Gretik’s game" (8356) with: Gretik, AlthalusBlack. Settings: map: World_Conquest_Start era: era_default XP: 80 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 01:51:11< lobby> nic ended game: "with 60 sec timer 2 vs 2" (8222) at turn: 40 with reason: 'game over'. (socket: 12603) 20120326 01:51:27< lobby> lulubell ended game: "ZachAttack’s game" (8337) at turn: 1 with reason: 'aborted'. (socket: 12775) 20120326 01:51:30< lobby> Legolas95 ended game: "legolaskiller’s game" (8283) at turn: 14 with reason: 'game over'. (socket: 12695) 20120326 01:52:05< lobby> ZachAttack started game: "ZachAttack’s game" (8358) with: ZachAttack, lulubell. Settings: map: user_map era: GLEE XP: 50 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 01:52:24< dicplobby> 20120326 01:52:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 01:53:04< lobby> 20120326 01:53:04 Statistics: number_of_games = 42 number_of_users = 147 lobby_users = 37 20120326 01:53:04< lobby> EpicFailGuy ended game: "EpicFailGuys Partie" (8300) at turn: 34 with reason: 'aborted' and disconnected. (socket: 12698) 20120326 01:55:01< lobby> dmr ended game: "dmr’s game" (8303) at turn: 11 with reason: 'game over'. (socket: 12657) 20120326 01:55:05< tuxlobby> 20120326 01:55:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 01:55:12< lobby> joebob started game: "joebob’s game" (8348) with: joebob, ilikeblue949, nic, zumbies, evea, essor. Settings: map: Colosseum_scenario era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 01:55:12< lobby> ShadowVeil started game: "ShadowVeil’s game" (8360) with: ShadowVeil, Danniel_BR. Settings: map: 3p_3p_dark_blood_traingle_dm era: Ageless RPG Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 01:55:29< lobby> clap started game: "clap’s game" (8357) with: clap, luismiguel, vbs1997, janiz. Settings: map: multiplayer_A_New_Land era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 01:56:23< lobby> BattleMaster started game: "Jeu de BattleMaster" (8361) with: BattleMaster, patriot. Settings: map: TL_WC_NM_Desert3 era: GLEE XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 01:56:58< lobby> joebob ended game: "joebob’s game" (8348) at turn: 1 with reason: 'aborted'. (socket: 12692) 20120326 01:57:21< lobby> Malthus started game: "Malthus’s game" (8363) with: Malthus. Settings: map: multiplayer_Clash era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 01:57:24< dicplobby> 20120326 01:57:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 01:58:04< lobby> 20120326 01:58:04 Statistics: number_of_games = 42 number_of_users = 144 lobby_users = 33 20120326 01:58:15< lobby> carlangas ended game: "carlangas’s game" (8297) at turn: 25 with reason: 'game over'. (socket: 12703) 20120326 01:58:50< lobby> kingjohn ended game: "saintmike’s game" (8216) at turn: 20 with reason: 'aborted'. (socket: 12595) 20120326 01:58:56< lobby> joebob started game: "joebob’s game" (8364) with: joebob, nic, zumbies, ilikeblue949, essor, evea. Settings: map: Colosseum_scenario era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 01:59:04< lobby> hi 20120326 01:59:16< lobby> ready 20120326 01:59:22< lobby> yes 20120326 01:59:37< lobby> do i start? 20120326 01:59:37< lobby> what are we playing? 20120326 01:59:43< lobby> yeah 20120326 01:59:49< lobby> okay 20120326 02:00:05< tuxlobby> 20120326 02:00:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 02:00:12< lobby> legolas is going to 20120326 02:00:21< lobby> ok 20120326 02:01:35< lobby> Malthu ended game: "Malthu’s game" (8317) at turn: 17 with reason: 'game over'. (socket: 12730) 20120326 02:02:25< dicplobby> 20120326 02:02:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 02:02:32< lobby> Buff ended game: "cupcake’s game RANDOM ONLY" (8159) at turn: 54 with reason: 'game over'. (socket: 12507) 20120326 02:02:45< lobby> Drogan started game: "Drogan’s game" (8369) with: Drogan, Mogs. Settings: map: 3pSurvival era: Ageless Era XP: 30 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 02:03:06< lobby> Sauroman11 started game: "nome de Sauroman11" (8371) with: Sauroman11, Clyff. Settings: map: vs_Survival_2p era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 02:03:32< lobby> 20120326 02:03:32 Statistics: number_of_games = 43 number_of_users = 141 lobby_users = 32 20120326 02:05:05< tuxlobby> 20120326 02:05:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 02:05:54< lobby> Orathoy ended game: "Grezdaed’s game" (8343) at turn: 28 with reason: 'game over'. (socket: 12647) 20120326 02:05:59< lobby> I5YKA ended game: "adun’s game" (8301) at turn: 13 with reason: 'game over'. (socket: 12708) 20120326 02:06:07< lobby> Grezdaed started game: "Grezdaed’s game" (8374) with: Grezdaed, Orathoy. Settings: map: CSABI_The_Prison era: era_default XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 02:07:24< dicplobby> 20120326 02:07:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 02:08:32< lobby> 20120326 02:08:32 Statistics: number_of_games = 42 number_of_users = 154 lobby_users = 35 20120326 02:08:54< lobby> ArmOrAttAk ended game: "ArmOrAttAk’s game" (8108) at turn: 63 with reason: 'game over'. (socket: 12404) 20120326 02:09:12< lobby> Zagz started game: "Zagz’s game" (8375) with: Zagz, Aemon, Jormundgandr, ExarKun. Settings: map: multiplayer_8p_Mokena_Prairie era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 02:10:04< lobby> ShadowVeil ended game: "ShadowVeil’s game" (8360) at turn: 35 with reason: 'game over'. (socket: 12781) 20120326 02:10:05< tuxlobby> 20120326 02:10:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 02:10:14< lobby> danni 20120326 02:10:15< lobby> lets try 20120326 02:10:17< lobby> with default 20120326 02:10:21< lobby> so that miguel can play xd 20120326 02:10:46< lobby> Syath started game: "Syath’s game" (8378) with: Syath, Carrera. Settings: map: multiplayer_Sullas_Ruins era: era_default XP: 110 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 02:11:01< lobby> miguel? 20120326 02:11:11< lobby> BalisterGrace started game: "BalisterGrace’s game" (8377) with: BalisterGrace. Settings: map: multiplayer_Basilisk era: era_default XP: 60 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 02:11:14< lobby> Miguel you thereeeee? 20120326 02:12:13< lobby> BalisterGrace ended game: "BalisterGrace’s game" (8377) at turn: 1 with reason: 'aborted'. (socket: 12804) 20120326 02:12:24< dicplobby> 20120326 02:12:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 02:12:41< lobby> MsEdyn ended game: "MsEdyn’s game" (8344) at turn: 22 with reason: 'game over'. (socket: 12528) 20120326 02:12:42< lobby> Trav_is_good ended game: "Trav_is_good’s game" (8305) at turn: 17 with reason: 'aborted'. (socket: 12715) 20120326 02:12:45< lobby> ChrisH started game: "ChrisH’s game" (8382) with: ChrisH, Jojolaffreux, kirin, Malik_Was_Here. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 02:13:08< lobby> kkk started game: "nome de kkk" (8386) with: kkk. Settings: map: multiplayer_Hexcake era: era_default XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 02:13:14< lobby> EternalGibbon started game: "EternalGibbon’s game" (8384) with: EternalGibbon, Realeyz, BalisterGrace, mumma. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 02:13:30< lobby> kkk ended game: "nome de kkk" (8386) at turn: 1 with reason: 'aborted'. (socket: 12807) 20120326 02:13:32< lobby> 20120326 02:13:32 Statistics: number_of_games = 42 number_of_users = 156 lobby_users = 39 20120326 02:14:18< lobby> joe 20120326 02:14:20< lobby> joe 20120326 02:14:22< lobby> joe 20120326 02:14:38< lobby> ShadowVeil started game: "ShadowVeil’s game" (8383) with: ShadowVeil, Danniel_BR, Miguel. Settings: map: 3p_3p_dark_blood_traingle_dm era: Colosseum_era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 02:14:44< lobby> alguem br ai 20120326 02:14:47< lobby> br 20120326 02:15:01< lobby> Velociraptor started game: "La partida de Velociraptor" (8388) with: Velociraptor. Settings: map: isars_blasphemy era: Ageless Era XP: 50 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 02:15:05< tuxlobby> 20120326 02:15:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 02:15:50< lobby> KalenzZ ended game: "Jeu de KalenzZ" (8308) at turn: 48 with reason: 'aborted'. (socket: 10980) 20120326 02:15:51< lobby> RicardoViramontes started game: "RicardoViramontes’s game" (8389) with: RicardoViramontes. Settings: map: Save The village era: era_default XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 02:16:05< lobby> Orathoy ended game: "Grezdaed’s game" (8374) at turn: 36 with reason: 'aborted'. (socket: 12647) 20120326 02:16:08< lobby> any one want 20120326 02:16:11< lobby> a ageless 20120326 02:16:17< lobby> Grezdaed started game: "Grezdaed’s game" (8392) with: Grezdaed, Orathoy. Settings: map: CSABI_The_Prison era: era_default XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 02:16:18< lobby> morde started game: "morde’s game" (8391) with: morde, HellButterfly. Settings: map: multiplayer_Basilisk era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 02:16:22< lobby> KalenzZ started game: "Jeu de KalenzZ" (8390) with: KalenzZ. Settings: map: SXRPG TheEvilDead era: Ageless RPG Era XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 02:17:08< lobby> :D 20120326 02:17:22< lobby> MsEdyn started game: "MsEdyn’s game" (8394) with: MsEdyn. Settings: map: multiplayer_thousand_stings_garrison era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 02:17:24< dicplobby> 20120326 02:17:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 02:18:32< lobby> 20120326 02:18:32 Statistics: number_of_games = 49 number_of_users = 154 lobby_users = 29 20120326 02:19:18< lobby> ZachAttack ended game: "ZachAttack’s game" (8358) at turn: 10 with reason: 'game over'. (socket: 12754) 20120326 02:19:21< lobby> Legolas95 started game: "Legolas95’s game" (8370) with: Legolas95, andy-pj, legolaskiller, benjammin22. Settings: map: multiplayer_The_Wilderlands era: era_arma_standard XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 02:19:23< lobby> ViralFerret ended game: "Kitoshide’s game" (8217) at turn: 61 with reason: 'game over'. (socket: 12634) 20120326 02:20:03< lobby> RicardoViramontes ended game: "RicardoViramontes’s game" (8389) at turn: 36 with reason: 'game over'. (socket: 12837) 20120326 02:20:05< tuxlobby> 20120326 02:20:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 02:20:07< lobby> FElo ended game: "(pls no noobs) MadMode@" (8077) at turn: 52 with reason: 'aborted'. (socket: 12286) 20120326 02:20:18< lobby> RicardoViramontes started game: "RicardoViramontes’s game" (8398) with: RicardoViramontes. Settings: map: Save The village era: era_default XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 02:20:23< lobby> Luluy started game: "nome de Luluy" (8393) with: Luluy, Gaymann. Settings: map: multiplayer_2p_Dark_Forecast era: era_heroes XP: 100 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 02:20:27< lobby> Eruadan started game: "Eruadan’s game" (8396) with: Eruadan, largefood, WarCry, tethien. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 02:21:35< lobby> jhcordeiro ended game: "ChrisH’s game" (8338) at turn: 11 with reason: 'game over'. (socket: 12759) 20120326 02:22:24< dicplobby> 20120326 02:22:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 02:22:37< lobby> KalenzZ ended game: "Jeu de KalenzZ" (8390) at turn: 49 with reason: 'aborted'. (socket: 10980) 20120326 02:22:53< lobby> adun started game: "adun’s game" (8387) with: adun, nielsen1, deepak, Skyvark. Settings: map: multiplayer_Clash era: era_heroes XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 02:23:04< lobby> :P 20120326 02:23:12< lobby> KalenzZ started game: "Jeu de KalenzZ" (8399) with: KalenzZ. Settings: map: SXRPG TheEvilDead era: Ageless RPG Era XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 02:23:22< lobby> jogador ended game: "nome de Ishimi" (8178) at turn: 41 with reason: 'game over'. (socket: 12492) 20120326 02:23:32< lobby> 20120326 02:23:32 Statistics: number_of_games = 45 number_of_users = 151 lobby_users = 37 20120326 02:23:49< lobby> KalenzZ ended game: "Jeu de KalenzZ" (8399) at turn: 49 with reason: 'aborted'. (socket: 10980) 20120326 02:23:59< lobby> RicardoViramontes ended game: "RicardoViramontes’s game" (8398) at turn: 37 with reason: 'game over'. (socket: 12837) 20120326 02:24:23< lobby> KalenzZ started game: "Jeu de KalenzZ" (8402) with: KalenzZ. Settings: map: SXRPG TheEvilDead era: Ageless RPG Era XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 02:24:42< lobby> OD ended game: "xivarmy’s game" (8339) at turn: 13 with reason: 'game over'. (socket: 12765) 20120326 02:25:05< tuxlobby> 20120326 02:25:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 02:25:11< lobby> KalenzZ ended game: "Jeu de KalenzZ" (8402) at turn: 49 with reason: 'aborted'. (socket: 10980) 20120326 02:25:47< lobby> KalenzZ started game: "Jeu de KalenzZ" (8404) with: KalenzZ. Settings: map: SXRPG TheEvilDead era: Ageless RPG Era XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 02:26:43< lobby> Creon ended game: "Creon’s game" (8330) at turn: 17 with reason: 'aborted'. (socket: 12644) 20120326 02:27:06< lobby> ilikeblue949 ended game: "joebob’s game" (8364) at turn: 13 with reason: 'aborted'. (socket: 12779) 20120326 02:27:09< lobby> KalenzZ ended game: "Jeu de KalenzZ" (8404) at turn: 49 with reason: 'aborted'. (socket: 10980) 20120326 02:27:25< dicplobby> 20120326 02:27:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 02:27:27< lobby> Zinnsoldat started game: "for Creon" (8408) with: Zinnsoldat, Creon. Settings: map: RMP_Conservative era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 02:27:29< lobby> Zinnsoldat advanced game: "for Creon" (8408) with: Zinnsoldat, Creon. Settings: map: RMP_Hamlets_21 era: XP: 70 GPV: fog: shroud: observers: shuffle: timer: 20120326 02:27:36< lobby> Malthus ended game: "Malthus’s game" (8363) at turn: 20 with reason: 'aborted'. (socket: 12721) 20120326 02:27:37< lobby> Jorge_Sao_Tome started game: "nome de Jorge_Sao_Tome" (8400) with: Jorge_Sao_Tome, WarRozan, o_0, nic. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 02:27:44< lobby> KalenzZ started game: "Jeu de KalenzZ" (8409) with: KalenzZ. Settings: map: SXRPG TheEvilDead era: Ageless RPG Era XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 02:28:32< lobby> 20120326 02:28:32 Statistics: number_of_games = 45 number_of_users = 146 lobby_users = 32 20120326 02:29:35< lobby> Gretik advanced game: "Gretik’s game" (8356) with: Gretik, AlthalusBlack. Settings: map: TL_WC_NM_Island2 era: XP: 80 GPV: fog: shroud: observers: shuffle: timer: 20120326 02:29:59< lobby> Lulubell started game: "Lulubell’s game" (8406) with: Lulubell, ZachAttack. Settings: map: multiplayer_A_New_Land era: GLEE XP: 50 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 02:30:06< tuxlobby> 20120326 02:30:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 02:30:58< lobby> Carrera ended game: "Syath’s game" (8378) at turn: 8 with reason: 'game over'. (socket: 12828) 20120326 02:31:29< lobby> paso ended game: "reload" (7760) at turn: 109 with reason: 'game over'. (socket: 11753) 20120326 02:32:24< dicplobby> 20120326 02:32:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 02:33:03< lobby> Adelmo-BR ended game: "nome de BR_Scotta" (8289) at turn: 16 with reason: 'game over'. (socket: 12811) 20120326 02:33:04< lobby> andy-pj ended game: "Legolas95’s game" (8370) at turn: 1 with reason: 'aborted'. (socket: 12787) 20120326 02:33:23< lobby> Velociraptor ended game: "La partida de Velociraptor" (8388) at turn: 11 with reason: 'game over'. (socket: 12836) 20120326 02:33:32< lobby> 20120326 02:33:32 Statistics: number_of_games = 43 number_of_users = 145 lobby_users = 34 20120326 02:33:41< lobby> mumma ended game: "EternalGibbon’s game" (8384) at turn: 5 with reason: 'aborted'. (socket: 12718) 20120326 02:34:12< lobby> amberj started game: "amberj’s game" (8410) with: amberj, xivarmy, Thirteen, Realeyz. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 02:34:15< lobby> FilthyHobbit started game: "FilthyHobbit’s game" (8413) with: FilthyHobbit, MrOrc, Velociraptor, Griffon. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 02:34:27< lobby> Braum started game: "Braum’s game" (8412) with: Braum, drfragz. Settings: map: multiplayer_Clash era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 02:34:32< lobby> MsEdyn ended game: "MsEdyn’s game" (8394) at turn: 11 with reason: 'game over'. (socket: 12528) 20120326 02:35:06< tuxlobby> 20120326 02:35:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 02:35:15< lobby> Legolas95 started game: "Legolas95’s game" (8414) with: Legolas95, benjammin22, andy-pj, legolaskiller. Settings: map: multiplayer_Forest_of_Fear era: era_arma_standard XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 02:35:36< lobby> Regalr ended game: "Minion’s game" (8264) at turn: 26 with reason: 'game over'. (socket: 11697) 20120326 02:36:42< lobby> Danniel_BR ended game: "ShadowVeil’s game" (8383) at turn: 31 with reason: 'game over'. (socket: 12636) 20120326 02:36:58< lobby> EternalGibbon started game: "EternalGibbon’s game" (8415) with: EternalGibbon, BalisterGrace, cp9, evea. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 02:36:58< lobby> Luluy ended game: "nome de Luluy" (8393) at turn: 7 with reason: 'aborted'. (socket: 12835) 20120326 02:37:20< lobby> UT_MWKICH ended game: "Fast game : P - without same units at start :P." (8309) at turn: 22 with reason: 'aborted'. (socket: 12639) 20120326 02:37:24< dicplobby> 20120326 02:37:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 02:38:03< lobby> ShadowVeil started game: "luck battles Danniel and company" (8417) with: ShadowVeil, Miguel, Danniel_BR. Settings: map: 3p_3p_dark_blood_traingle_dm era: Colosseum_era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 02:38:32< lobby> 20120326 02:38:32 Statistics: number_of_games = 40 number_of_users = 149 lobby_users = 35 20120326 02:38:34< lobby> Miguel ended game: "luck battles Danniel and company" (8417) at turn: 1 with reason: 'aborted'. (socket: 12819) 20120326 02:38:47< lobby> Orathoy ended game: "Grezdaed’s game" (8392) at turn: 57 with reason: 'aborted'. (socket: 12647) 20120326 02:39:39< lobby> Grezdaed started game: "Grezdaed’s game" (8421) with: Grezdaed, Orathoy. Settings: map: CSABI_The_Prison era: era_default XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 02:39:47< lobby> Orathoy ended game: "Grezdaed’s game" (8421) at turn: 38 with reason: 'aborted'. (socket: 12647) 20120326 02:40:06< tuxlobby> 20120326 02:40:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 02:40:22< lobby> Grezdaed started game: "Grezdaed’s game" (8424) with: Grezdaed, Orathoy. Settings: map: CSABI_The_Prison era: era_default XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 02:40:32< lobby> Orathoy ended game: "Grezdaed’s game" (8424) at turn: 45 with reason: 'aborted'. (socket: 12647) 20120326 02:40:32< lobby> ShadowVeil started game: "lkerpeta Danniel Shadow Miguel" (8420) with: ShadowVeil, Danniel_BR, Miguel, Mrzinzin. Settings: map: 4p_deathmatch_duel_dm.cfg era: Colosseum_era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 02:40:46< lobby> Tanorik ended game: "Random_Man92’s game" (8332) at turn: 16 with reason: 'aborted'. (socket: 12686) 20120326 02:40:47< lobby> Incomp started game: "Incomp’s game" (8422) with: Incomp, Irazel, Maplehoof, 5in7. Settings: map: multiplayer_Loris_River era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 02:41:09< lobby> Grezdaed started game: "Grezdaed’s game" (8425) with: Grezdaed, Orathoy. Settings: map: CSABI_The_Prison era: era_default XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 02:41:38< lobby> Limon started game: "nome de Limon" (8405) with: Limon, Cyofero, Arthasss, Miguis. Settings: map: Colosseum_scenario era: Ageless RPG Era XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 02:41:56< lobby> cupcake started game: "cupcake’s game RANDOM ONLY" (8411) with: cupcake, essor, hetial, DelphiniumandLoug, Hakun. Settings: map: Creep War New Map v0.2.6 era: Creep_Era XP: 60 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 02:42:05< lobby> Miguis ended game: "nome de Limon" (8405) at turn: 1 with reason: 'aborted'. (socket: 11917) 20120326 02:42:24< dicplobby> 20120326 02:42:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 02:42:47< lobby> ge85222 started game: "nome de ge85222" (8426) with: ge85222, UT_MWKICH. Settings: map: multiplayer_2p_Dark_Forecast era: era_heroes XP: 100 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 02:43:03< lobby> AlthalusBlack ended game: "Gretik’s game" (8356) at turn: 5 with reason: 'game over'. (socket: 12780) 20120326 02:43:18< lobby> Grezdaed advanced game: "Grezdaed’s game" (8425) with: Grezdaed, Orathoy. Settings: map: CSABI_The_Valley_of_the_Fear era: XP: 100% GPV: fog: shroud: observers: shuffle: timer: 20120326 02:43:32< lobby> 20120326 02:43:32 Statistics: number_of_games = 40 number_of_users = 144 lobby_users = 27 20120326 02:44:07< lobby> Sauroman11 ended game: "nome de Sauroman11" (8371) at turn: 13 with reason: 'game over'. (socket: 12802) 20120326 02:44:24< lobby> Limon started game: "nome de Limon" (8427) with: Limon, Cyofero, Arthasss, Miguis. Settings: map: Colosseum_scenario era: Ageless RPG Era XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 02:44:54< lobby> Tanorik started game: "Tanorik’s game" (8430) with: Tanorik. Settings: map: multiplayer_The_Freelands era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 02:45:05< tuxlobby> 20120326 02:45:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 02:46:45< lobby> Mogs ended game: "Drogan’s game" (8369) at turn: 13 with reason: 'aborted'. (socket: 12799) 20120326 02:47:24< dicplobby> 20120326 02:47:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 02:47:33< lobby> Drogan started game: "Drogan’s game" (8431) with: Drogan, Mogs. Settings: map: 3pSurvival era: Ageless Era XP: 30 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 02:48:32< lobby> 20120326 02:48:32 Statistics: number_of_games = 40 number_of_users = 143 lobby_users = 27 20120326 02:48:36< lobby> Kitoshide started game: "Kitoshide’s game" (8428) with: Kitoshide, ViralFerret, TheCultHero. Settings: map: ice era: Ageless Era XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 02:49:01< lobby> cupcake 20120326 02:50:04< lobby> anyone hear how thatgame turned out last night at ten pacific 20120326 02:50:05< tuxlobby> 20120326 02:50:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 02:50:35< lobby> ksz ended game: "MOD MODE" (8323) at turn: 47 with reason: 'game over'. (socket: 12758) 20120326 02:51:05< lobby> ViralFerret ended game: "Kitoshide’s game" (8428) at turn: 1 with reason: 'out of sync'. (socket: 12875) 20120326 02:51:08< lobby> very funny 20120326 02:51:35< lobby> X was going on yesterday about a game vs you at ten 20120326 02:51:58< lobby> i couldnt find it on the replays wondering if you won or X did 20120326 02:52:16< lobby> Malik_Was_Here ended game: "ChrisH’s game" (8382) at turn: 8 with reason: 'game over'. (socket: 12808) 20120326 02:52:18< lobby> he was claiming hodor 20120326 02:52:25< dicplobby> 20120326 02:52:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 02:52:36< lobby> KalenzZ ended game: "Jeu de KalenzZ" (8409) at turn: 57 with reason: 'aborted'. (socket: 10980) 20120326 02:52:38< lobby> Kitoshide started game: "Kitoshide’s game" (8437) with: Kitoshide, TheCultHero, ViralFerret. Settings: map: ice era: Ageless Era XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 02:52:39< lobby> so who won ???? 20120326 02:52:46< dicplobby> papou has logged on. (socket: 60) 20120326 02:52:52< lobby> Clyff started game: "Average" (8434) with: Clyff, jfitt, Sauroman11, Heron, DelphiniumandLoug, Malik_Was_Here. Settings: map: Colosseum_scenario era: Colosseum_era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 02:53:18< lobby> Cyofero ended game: "nome de Limon" (8427) at turn: 5 with reason: 'aborted'. (socket: 11911) 20120326 02:53:29< lobby> KalenzZ started game: "Jeu de KalenzZ" (8440) with: KalenzZ. Settings: map: SXRPG TheEvilDead era: Ageless RPG Era XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 02:53:32< lobby> 20120326 02:53:32 Statistics: number_of_games = 41 number_of_users = 145 lobby_users = 35 20120326 02:53:34< lobby> so i take it mystic lost?? 20120326 02:53:49< lobby> ill find out whats up later 20120326 02:53:56< lobby> ChrisH started game: "ChrisH’s game" (8439) with: ChrisH, o_0, Hakun, hetial. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 02:54:14< dicplobby> Et_Le_Cruel has logged on. (socket: 61) 20120326 02:54:34< lobby> anyone else know or what 20120326 02:54:39< dicplobby> Attack attaque attaque 20120326 02:54:49< lobby> you are most likely a single person.. 20120326 02:54:54< dicplobby> tactactatctatctactatctat 20120326 02:55:02< dicplobby> yahou 20120326 02:55:02< lobby> ive been using this name for years 20120326 02:55:04< lobby> Stenen_ ended game: "La partida de Kalyra" (8249) at turn: 17 with reason: 'game over'. (socket: 12650) 20120326 02:55:05< tuxlobby> 20120326 02:55:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 02:55:07< lobby> WarRozan ended game: "nome de Jorge_Sao_Tome" (8400) at turn: 7 with reason: 'game over'. (socket: 12848) 20120326 02:55:13< dicplobby> Simonstre has logged on. (socket: 62) 20120326 02:55:13< dicplobby> défonceur 20120326 02:55:13< lobby> havent changed it ever for any games 20120326 02:55:14< lobby> sure, whatever 20120326 02:55:18< dicplobby> yéoumomo 20120326 02:55:21< lobby> I have nothing more to say to you 20120326 02:55:23< dicplobby> yela 20120326 02:55:38< lobby> Woo 20120326 02:55:38< lobby> kk so you lost 20120326 02:55:42< lobby> vbs1997 ended game: "clap’s game" (8357) at turn: 10 with reason: 'aborted'. (socket: 12771) 20120326 02:55:45< lobby> Limon started game: "nome de Limon" (8441) with: Limon, Cyofero, Arthasss, Miguis. Settings: map: Colosseum_scenario era: Ageless RPG Era XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 02:56:01< dicplobby> Simonstre started game: "Jeu de Simonstre" (26) with: Simonstre, papou, Et_Le_Cruel. Settings: map: TL_WC_NM_Island2 era: XP_Era XP: GPV: fog: shroud: observers: yes timer: 20120326 02:56:04< lobby> Nephrite ended game: "2on2 isars" (8349) at turn: 13 with reason: 'aborted'. (socket: 12664) 20120326 02:56:29< lobby> wtf just happend 20120326 02:56:52< lobby> clap started game: "clap’s game" (8443) with: clap, luismiguel, Playa. Settings: map: multiplayer_A_New_Land era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 02:56:58< lobby> Atasco started game: "Atasco’s game" (8445) with: Atasco, jhcordeiro, Zwirni, essor. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 02:57:00< lobby> xor1337 ended game: "cupcake’s game RANDOM ONLY" (8411) at turn: 5 with reason: 'aborted'. (socket: 12888) 20120326 02:57:23< dicplobby> papou ended game: "Jeu de Simonstre" (26) at turn: 6 with reason: 'aborted'. (socket: 60) 20120326 02:57:26< dicplobby> 20120326 02:57:24 Statistics: number_of_games = 0 number_of_users = 3 lobby_users = 3 20120326 02:57:35< dicplobby> pourri! 20120326 02:57:47< dicplobby> tu peux en creer une autre 20120326 02:58:04< dicplobby> meme si tes laid pis tu pues 20120326 02:58:05< lobby> vbs1997 started game: "nome de vbs1997" (8448) with: vbs1997. Settings: map: multiplayer_King_of_the_Hill era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 02:58:06< lobby> ?????????? 20120326 02:58:15< lobby> Zwirni ended game: "Atasco’s game" (8445) at turn: 1 with reason: 'aborted'. (socket: 12757) 20120326 02:58:18< lobby> Cyofero ended game: "nome de Limon" (8441) at turn: 1 with reason: 'aborted'. (socket: 11911) 20120326 02:58:32< lobby> 20120326 02:58:32 Statistics: number_of_games = 39 number_of_users = 143 lobby_users = 33 20120326 02:58:48< lobby> Jorge_Sao_Tome started game: "Juninho e' gay | Pau nele..." (8444) with: Jorge_Sao_Tome, Miszcz, WarRozan, jhcordeiro. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 02:58:49< dicplobby> yalongtemps 20120326 02:58:57< dicplobby> pas bon 20120326 02:59:08< lobby> Atasco started game: "Atasco’s game" (8450) with: Atasco, Zwirni, gg, Ikerpeta. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 02:59:08< dicplobby> toetou 20120326 02:59:14< dicplobby> Simonstre started game: "Jeu de Simonstre" (28) with: Simonstre, Et_Le_Cruel, papou. Settings: map: World_Conquest era: XP_Era XP: GPV: fog: shroud: observers: yes timer: 20120326 02:59:38< lobby> n 20120326 03:00:05< tuxlobby> 20120326 03:00:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 03:00:22< lobby> Miguis started game: "nome de Miguis" (8452) with: Miguis, Cyofero. Settings: map: Colosseum_scenario era: Ageless RPG Era XP: 30 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 03:00:48< lobby> Stenen ended game: "Jeu de ferun" (8126) at turn: 24 with reason: 'game over'. (socket: 12058) 20120326 03:01:18< lobby> SKS ended game: "Jeu de Jojolaffreux" (8327) at turn: 10 with reason: 'aborted'. (socket: 12753) 20120326 03:01:35< lobby> cupcake started game: "cupcake’s game RANDOM HERO ONLY" (8446) with: cupcake, nic, xor1337, essor, Jaglavak. Settings: map: Creep War New Map v0.2.6 era: Creep_Era XP: 60 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 03:02:13< lobby> Haunter ended game: "Incomp’s game" (8422) at turn: 6 with reason: 'aborted'. (socket: 12748) 20120326 03:02:24< dicplobby> 20120326 03:02:24 Statistics: number_of_games = 1 number_of_users = 3 lobby_users = 0 20120326 03:02:57< lobby> Mrzinzin ended game: "lkerpeta Danniel Shadow Miguel" (8420) at turn: 23 with reason: 'game over'. (socket: 12866) 20120326 03:03:40< lobby> Ikerpeta ended game: "Atasco’s game" (8450) at turn: 1 with reason: 'aborted'. (socket: 12871) 20120326 03:03:47< lobby> ge85222 ended game: "nome de ge85222" (8426) at turn: 18 with reason: 'aborted'. (socket: 12881) 20120326 03:03:48< lobby> 20120326 03:03:48 Statistics: number_of_games = 38 number_of_users = 139 lobby_users = 28 20120326 03:04:01< lobby> Irazel started game: "Irazel’s game" (8454) with: Irazel, Incomp, Haunter, Atmohspheer. Settings: map: multiplayer_4p_Underworld era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 03:04:05< lobby> Atasco started game: "Atasco’s game" (8456) with: Atasco, Zwirni, SKS, Ikerpeta. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 03:04:24< lobby> WarCry ended game: "Eruadan’s game" (8396) at turn: 11 with reason: 'game over'. (socket: 12842) 20120326 03:04:25< lobby> Battleturtle started game: "Battleturtle’s game" (8455) with: Battleturtle, Ub3rPenguin, Wafa, Buroku. Settings: map: multiplayer_Blue_Water_Province era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 03:04:29< lobby> ShadowVeil started game: "2v2 for power dudes" (8457) with: ShadowVeil, Danniel_BR, Miguel, gg. Settings: map: multiplayer_4p_Morituri era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 03:04:30< lobby> Minion started game: "Minion’s game" (8453) with: Minion, CenetaurmanE52, NightMagus. Settings: map: (A New Land Classic)The Last Stand era: (A New Land Classic)A New Land:Standard XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 03:04:56< lobby> KalenzZ ended game: "Jeu de KalenzZ" (8440) at turn: 60 with reason: 'aborted'. (socket: 10980) 20120326 03:05:05< tuxlobby> 20120326 03:05:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 03:05:31< lobby> KalenzZ started game: "Jeu de KalenzZ" (8460) with: KalenzZ. Settings: map: SXRPG TheEvilDead era: Ageless RPG Era XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 03:06:27< tuxlobby> Slaverzero has logged on. (socket: 25221) 20120326 03:07:24< dicplobby> 20120326 03:07:24 Statistics: number_of_games = 1 number_of_users = 3 lobby_users = 0 20120326 03:07:31< lobby> ShadowVeil ended game: "2v2 for power dudes" (8457) at turn: 2 with reason: 'aborted'. (socket: 12781) 20120326 03:07:43< lobby> Im definitely here you morons 20120326 03:08:08< lobby> ShadowVeil started game: "2v2" (8462) with: ShadowVeil, Danniel_BR, Miguel, mumma. Settings: map: multiplayer_4p_Morituri era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 03:08:18< lobby> mystic_X_the_unknown is morons 20120326 03:08:37< lobby> lololololloollllooollololoollolololo 20120326 03:08:38< lobby> ldsfdsf 20120326 03:08:38< lobby> dfd 20120326 03:08:39< lobby> f 20120326 03:08:48< lobby> 20120326 03:08:48 Statistics: number_of_games = 40 number_of_users = 144 lobby_users = 30 20120326 03:08:48< lobby> d 20120326 03:08:48< lobby> d 20120326 03:08:48< lobby> df 20120326 03:08:49< lobby> asdf 20120326 03:08:53< tuxlobby> jugador has logged on. (socket: 25222) 20120326 03:08:59< lobby> dfs 20120326 03:08:59< lobby> df 20120326 03:08:59< lobby> df 20120326 03:08:59< lobby> dff 20120326 03:09:39< lobby> ff 20120326 03:09:39< lobby> ff 20120326 03:09:40< lobby> f 20120326 03:09:40< lobby> ds 20120326 03:09:50< lobby> ds 20120326 03:09:50< lobby> f 20120326 03:09:50< lobby> sd 20120326 03:09:50< lobby> fds 20120326 03:09:51< lobby> kurono started game: "La partida de kurono" (8461) with: kurono, carlangas. Settings: map: multiplayer_2p_Dark_Forecast era: era_default XP: 90 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 03:10:05< tuxlobby> 20120326 03:10:05 Statistics: number_of_games = 1 number_of_users = 2 lobby_users = 1 20120326 03:10:28< tuxlobby> jugador has logged off. (socket: 25222) 20120326 03:10:33< lobby> Mystic_X_the_unknown your a bitch 20120326 03:10:34< lobby> sd 20120326 03:10:34< lobby> f 20120326 03:10:34< lobby> Magnesia ended game: "FebrezeBrother’s game" (8320) at turn: 14 with reason: 'aborted'. (socket: 12725) 20120326 03:10:34< lobby> ads 20120326 03:10:36< lobby> KalenzZ ended game: "Jeu de KalenzZ" (8460) at turn: 61 with reason: 'aborted'. (socket: 10980) 20120326 03:11:04< lobby> Fuck you Cackfiend dedeeddefd 20120326 03:11:04< lobby> e 20120326 03:11:04< lobby> e 20120326 03:11:05< lobby> d 20120326 03:11:12< lobby> KalenzZ started game: "Jeu de KalenzZ" (8465) with: KalenzZ. Settings: map: SXRPG TheEvilDead era: Ageless RPG Era XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 03:11:38< lobby> cow started game: "cow的游戏" (8464) with: cow, ge85222. Settings: map: multiplayer_Basilisk era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 03:11:47< lobby> KalenzZ ended game: "Jeu de KalenzZ" (8465) at turn: 61 with reason: 'aborted'. (socket: 10980) 20120326 03:12:23< lobby> KalenzZ started game: "Jeu de KalenzZ" (8466) with: KalenzZ. Settings: map: SXRPG TheEvilDead era: Ageless RPG Era XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 03:12:24< dicplobby> 20120326 03:12:24 Statistics: number_of_games = 1 number_of_users = 3 lobby_users = 0 20120326 03:12:33< lobby> lol 20120326 03:12:41< lobby> alright.. 20120326 03:12:45< lobby> enough of this 20120326 03:13:08< lobby> Zeus ended game: "MCP’s game" (8164) at turn: 52 with reason: 'out of sync'. (socket: 12506) 20120326 03:13:36< lobby> MCP started game: "MCP’s game" (8468) with: MCP, Zeus. Settings: map: SXRPG CastleOfCantar era: SX RPG Era XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 03:13:48< lobby> 20120326 03:13:48 Statistics: number_of_games = 40 number_of_users = 143 lobby_users = 33 20120326 03:13:53< lobby> HellButterfly ended game: "morde’s game" (8391) at turn: 21 with reason: 'game over'. (socket: 12826) 20120326 03:14:02< lobby> Heartbreakhero started game: "Heartbreakhero’s game" (8469) with: Heartbreakhero, CastleCroquet. Settings: map: multiplayer_Loris_River era: era_magic_masters_0.17.0 XP: 100 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 03:14:35< lobby> such a sorry creature.. 20120326 03:14:47< lobby> Miguis ended game: "nome de Miguis" (8452) at turn: 11 with reason: 'aborted'. (socket: 11917) 20120326 03:14:49< tuxlobby> kokis has logged on. (socket: 25223) 20120326 03:15:05< tuxlobby> 20120326 03:15:05 Statistics: number_of_games = 1 number_of_users = 2 lobby_users = 0 20120326 03:15:06< lobby> glad he won't be around for a while now 20120326 03:15:32< lobby> Wafa ended game: "Battleturtle’s game" (8455) at turn: 3 with reason: 'aborted'. (socket: 12914) 20120326 03:15:55< lobby> ZeranSL started game: "ZeranSL’s game" (8467) with: ZeranSL, Eliza. Settings: map: multiplayer_Random_Map era: Ageless Era XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 03:16:10< tuxlobby> Slaverzero started game: "La partida de Slaverzero" (15320) with: Slaverzero, kokis. Settings: map: multiplayer_Random_Map era: ARCHAIC_ERA_RPG XP: 70 GPV: fog: shroud: observers: yes timer: 20120326 03:16:21< tuxlobby> Thog has logged on. (socket: 25224) 20120326 03:16:25< tuxlobby> Deler has logged on. (socket: 25225) 20120326 03:16:36< tuxlobby> Thog has logged off. (socket: 25224) 20120326 03:16:55< lobby> mumma ended game: "2v2" (8462) at turn: 4 with reason: 'aborted'. (socket: 12905) 20120326 03:17:25< dicplobby> 20120326 03:17:24 Statistics: number_of_games = 1 number_of_users = 3 lobby_users = 0 20120326 03:17:28< lobby> Dhill started game: "La partida de Dhill" (8470) with: Dhill, BrokenBones. Settings: map: multiplayer_Auction-X era: Ageless Era XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 03:17:32< lobby> Ub3rPenguin started game: "Ub3rPenguin’s game" (8471) with: Ub3rPenguin, Wafa, Buroku. Settings: map: multiplayer_Island_of_the_Horatii era: era_default XP: 60 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 03:17:47< tuxlobby> Deler has logged off. (socket: 25225) 20120326 03:17:59< tuxlobby> kokis ended game: "La partida de Slaverzero" (15320) at turn: 2 with reason: 'out of sync'. (socket: 25223) 20120326 03:18:47< lobby> O-Nasan started game: "O-Nasan’s game" (8472) with: O-Nasan, zaji970. Settings: map: multiplayer_Siege_Castles era: era_default XP: 30 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 03:18:48< lobby> 20120326 03:18:48 Statistics: number_of_games = 42 number_of_users = 140 lobby_users = 29 20120326 03:18:58< tuxlobby> Slaverzero started game: "La partida de Slaverzero" (15321) with: Slaverzero, kokis. Settings: map: multiplayer_Random_Map era: era_ime_0.0.6 XP: 70 GPV: fog: shroud: observers: yes timer: 20120326 03:19:10< lobby> Estagar started game: "Estagar’s game - 150 timer" (8474) with: Estagar, foxtrot, default, Heraklinos. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 03:19:41< lobby> ShadowVeil started game: "2v2" (8476) with: ShadowVeil, Miguel, Danniel_BR, Madmoo. Settings: map: multiplayer_4p_Morituri era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 03:20:05< tuxlobby> 20120326 03:20:05 Statistics: number_of_games = 1 number_of_users = 2 lobby_users = 0 20120326 03:20:05< lobby> what happened? 20120326 03:21:48< lobby> ge85222 ended game: "cow的游戏" (8464) at turn: 3 with reason: 'aborted'. (socket: 12881) 20120326 03:22:24< dicplobby> 20120326 03:22:24 Statistics: number_of_games = 1 number_of_users = 3 lobby_users = 0 20120326 03:23:48< lobby> 20120326 03:23:48 Statistics: number_of_games = 42 number_of_users = 141 lobby_users = 28 20120326 03:24:10< lobby> cow started game: "cow的游戏" (8478) with: cow, PAS. Settings: map: multiplayer_Basilisk era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 03:25:05< tuxlobby> 20120326 03:25:05 Statistics: number_of_games = 1 number_of_users = 2 lobby_users = 0 20120326 03:25:20< lobby> Bulg started game: "Bulg’s game" (8483) with: Bulg. Settings: map: multiplayer_Castle_Hopping_Isle era: era_default XP: 60 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 03:25:26-!- noy [~Noy@wesnoth/developer/noy] has quit [Quit: GO, GET TO THE CHOPPAH!!!] 20120326 03:25:46< lobby> Creon ended game: "for Creon" (8408) at turn: 26 with reason: 'game over'. (socket: 12644) 20120326 03:26:05< lobby> Bulg ended game: "Bulg’s game" (8483) at turn: 1 with reason: 'aborted'. (socket: 12969) 20120326 03:26:18-!- noy [~Noy@wesnoth/developer/noy] has joined #wesnoth-mp-lobby-stable 20120326 03:26:22-!- mode/#wesnoth-mp-lobby-stable [+o noy] by ChanServ 20120326 03:27:14< tuxlobby> kokis ended game: "La partida de Slaverzero" (15321) at turn: 4 with reason: 'out of sync'. (socket: 25223) 20120326 03:27:24< dicplobby> 20120326 03:27:24 Statistics: number_of_games = 1 number_of_users = 3 lobby_users = 0 20120326 03:28:05< lobby> opa 20120326 03:28:30< lobby> <-Gomes-BR-> jogar o que? 20120326 03:28:45< tuxlobby> jugador has logged on. (socket: 25226) 20120326 03:28:46< lobby> ueu crio 20120326 03:28:48< lobby> 20120326 03:28:48 Statistics: number_of_games = 41 number_of_users = 148 lobby_users = 33 20120326 03:28:48< lobby> rs 20120326 03:29:02< lobby> sem problema 20120326 03:29:07< lobby> <-Gomes-BR-> ranking 20120326 03:29:14< lobby> <-Gomes-BR-> dai so se pode em ingles 20120326 03:29:21< tuxlobby> Slaverzero started game: "La partida de Slaverzero" (15322) with: Slaverzero, kokis, jugador. Settings: map: multiplayer_Alirok_Marsh era: era_default XP: 70 GPV: fog: shroud: observers: yes timer: 20120326 03:29:22< lobby> <-Gomes-BR-> como está o cavalo? 20120326 03:29:30< lobby> <-Gomes-BR-> xria Adelmo 20120326 03:29:34< lobby> <-Gomes-BR-> cria* 20120326 03:29:43< lobby> evea ended game: "EternalGibbon’s game" (8415) at turn: 12 with reason: 'aborted'. (socket: 12770) 20120326 03:29:49< lobby> voltou a andar mas está mancando de uma perna 20120326 03:30:05< tuxlobby> 20120326 03:30:05 Statistics: number_of_games = 1 number_of_users = 3 lobby_users = 0 20120326 03:30:13< lobby> <-Gomes-BR-> hmm 20120326 03:30:17< lobby> <-Gomes-BR-> mas ja ta melhor 20120326 03:30:19< lobby> então! 20120326 03:30:34< lobby> sim 20120326 03:30:37< lobby> cria ae um de 3 agora 20120326 03:30:38< lobby> mclaro mais foi mais de 3 horas para desatolar ele 20120326 03:30:46< lobby> um que vamos todos aliados 20120326 03:30:58< lobby> eu tenho Orocia 20120326 03:31:11< lobby> <-Gomes-BR-> se kiser pode criar então 20120326 03:31:12< lobby> olá 20120326 03:31:19< lobby> <-Gomes-BR-> hey Luiz 20120326 03:31:23< lobby> não 20120326 03:31:26< lobby> cria ae 20120326 03:31:26< lobby> <-Gomes-BR-> agora pra 4 pessoas XD 20120326 03:31:30< lobby> sim 20120326 03:31:31< lobby> ;) 20120326 03:31:32< lobby> <-Gomes-BR-> o Luiz ta ai 20120326 03:31:36< lobby> cria ae 20120326 03:31:37< lobby> um de quatro eu não conheço!!!!! 20120326 03:31:42< lobby> <-Gomes-BR-> hmmm 20120326 03:31:48< lobby> cria ae! 20120326 03:31:50< lobby> <-Gomes-BR-> pensei malicia malz 20120326 03:31:58< lobby> [tá bom eu vou criar 20120326 03:32:11< lobby> <-Gomes-BR-> qualker 1 pode ser 20120326 03:32:24< dicplobby> 20120326 03:32:24 Statistics: number_of_games = 1 number_of_users = 3 lobby_users = 0 20120326 03:32:29< lobby> <-Gomes-BR-> vão lá 20120326 03:32:35< lobby> <-Gomes-BR-> eu vo ser observer 20120326 03:32:41< lobby> <-Gomes-BR-> XD 20120326 03:32:45< lobby> <-Gomes-BR-> vamo Isar 2x2? 20120326 03:32:53< lobby> então entrem pois oscara já entraram 20120326 03:32:54< lobby> ah não 20120326 03:33:02< lobby> ae 20120326 03:33:04< lobby> pera 20120326 03:33:06< lobby> to cansado de 2x2 20120326 03:33:10< lobby> <-Gomes-BR-> kem tem creep war 20120326 03:33:12< lobby> tem um mapa bom todo pra ir 2x2 20120326 03:33:13< lobby> <-Gomes-BR-> ? 20120326 03:33:18< lobby> eu 20120326 03:33:19< lobby> <-Gomes-BR-> creep war 2x2 20120326 03:33:22< lobby> boco started game: "boco’s game" (8490) with: boco, Duris. Settings: map: ktv era: era_default XP: 50 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 03:33:27< lobby> <-Gomes-BR-> cria ai então 20120326 03:33:32< lobby> criem ae que eu entro 20120326 03:33:35< lobby> se e o jeito que assim seja 20120326 03:33:42< lobby> <-Gomes-BR-> shauhsah 20120326 03:33:48< lobby> 20120326 03:33:48 Statistics: number_of_games = 43 number_of_users = 153 lobby_users = 39 20120326 03:33:48< lobby> <-Gomes-BR-> gente indecisa XD 20120326 03:34:06< lobby> drfragz ended game: "Braum’s game" (8412) at turn: 28 with reason: 'game over'. (socket: 12867) 20120326 03:34:33< lobby> ExarKun ended game: "Zagz’s game" (8375) at turn: 12 with reason: 'game over'. (socket: 12816) 20120326 03:34:50< lobby> CircleJerker started game: "CircleJerker’s game" (8485) with: CircleJerker, Bashira, TragicAce. Settings: map: multiplayer_The_Royal_Rumble_Lavaville era: Ageless Era XP: 30 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 03:35:05< tuxlobby> 20120326 03:35:05 Statistics: number_of_games = 1 number_of_users = 3 lobby_users = 0 20120326 03:35:36< lobby> cow ended game: "cow的游戏" (8478) at turn: 5 with reason: 'aborted'. (socket: 12935) 20120326 03:35:41< lobby> hetial ended game: "ChrisH’s game" (8439) at turn: 12 with reason: 'aborted'. (socket: 12815) 20120326 03:35:56< lobby> ZachAttack ended game: "Lulubell’s game" (8406) at turn: 10 with reason: 'aborted'. (socket: 12754) 20120326 03:36:09< lobby> LuizBR started game: "nome de LuizBR" (8491) with: LuizBR, -Gomes-BR-, DelphiniumandLoug, Adelmo-BR. Settings: map: Creep War v0.2.11.1 era: Creep_Era_v0.2.11.1 XP: 60 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 03:36:49< lobby> ChrisH started game: "ChrisH’s game" (8495) with: ChrisH, EternalGibbon, BalisterGrace, TsAK. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 03:37:11< lobby> cow started game: "cow的游戏" (8496) with: cow, joseh. Settings: map: multiplayer_Basilisk era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 03:37:23< lobby> kkk started game: "nome de kkk" (8492) with: kkk, babaOriley, PAS. Settings: map: multiplayer_6p_Team_Survival era: era_heroes XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 03:37:23< lobby> Ub3rPenguin ended game: "Ub3rPenguin’s game" (8471) at turn: 8 with reason: 'aborted'. (socket: 12952) 20120326 03:37:24< dicplobby> 20120326 03:37:24 Statistics: number_of_games = 1 number_of_users = 3 lobby_users = 0 20120326 03:38:19< lobby> Zagz started game: "Zagz’s game" (8498) with: Zagz, Jormundgandr, Aemon, ExarKun. Settings: map: multiplayer_8p_Morituri era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 03:38:22< lobby> Bulg started game: "Bulg’s game" (8484) with: Bulg, bruisehound. Settings: map: multiplayer_Castle_Hopping_Isle era: era_default XP: 60 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 03:38:48< lobby> 20120326 03:38:48 Statistics: number_of_games = 43 number_of_users = 151 lobby_users = 32 20120326 03:39:23< lobby> Sir_Draco started game: "Sir_Draco’s game" (8500) with: Sir_Draco, Professor_Shadow. Settings: map: user_map era: era_heroes XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 03:39:25< dicplobby> yohel has logged on. (socket: 63) 20120326 03:39:29< dicplobby> yohel has logged off. (socket: 63) 20120326 03:40:05< tuxlobby> 20120326 03:40:05 Statistics: number_of_games = 1 number_of_users = 3 lobby_users = 0 20120326 03:40:09< lobby> Ub3rPenguin started game: "Ub3rPenguin’s game" (8501) with: Ub3rPenguin, Wafa, Buroku3. Settings: map: multiplayer_Alirok_Marsh era: era_default XP: 30 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 03:40:29< dicplobby> Simonstre advanced game: "Jeu de Simonstre" (28) with: Simonstre, Et_Le_Cruel, papou. Settings: map: TL_WC_NM_Island2 era: XP: 80 GPV: fog: shroud: observers: timer: 20120326 03:41:12< lobby> Mogs ended game: "Drogan’s game" (8431) at turn: 17 with reason: 'aborted'. (socket: 12799) 20120326 03:41:13< lobby> Bashira ended game: "CircleJerker’s game" (8485) at turn: 2 with reason: 'game over'. (socket: 12907) 20120326 03:41:20< lobby> platypus started game: "platypus’s game" (8504) with: platypus, TheVeneGuy. Settings: map: multiplayer_Sablestone_Delta era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 03:42:25< dicplobby> 20120326 03:42:24 Statistics: number_of_games = 1 number_of_users = 3 lobby_users = 0 20120326 03:43:27< lobby> joseh ended game: "cow的游戏" (8496) at turn: 3 with reason: 'aborted'. (socket: 12992) 20120326 03:43:33< lobby> ZachAttack started game: "ZachAttack’s game" (8505) with: ZachAttack, Lulubell. Settings: map: user_map era: GLEE XP: 50 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 03:43:35< lobby> cow started game: "cow的游戏" (8508) with: cow, mumma. Settings: map: multiplayer_Basilisk era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 03:43:48< lobby> 20120326 03:43:48 Statistics: number_of_games = 47 number_of_users = 152 lobby_users = 27 20120326 03:43:50< lobby> 13arrage started game: "13arrage’s game" (8502) with: 13arrage, unban_dta, Yarghenforgen. Settings: map: 3pSurvival era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 03:44:25< lobby> artase ended game: "Anibal’s game" (8302) at turn: 16 with reason: 'aborted'. (socket: 2554) 20120326 03:44:42< lobby> KalenzZ ended game: "Jeu de KalenzZ" (8466) at turn: 70 with reason: 'aborted'. (socket: 10980) 20120326 03:44:54< lobby> nielsen1 ended game: "adun’s game" (8387) at turn: 8 with reason: 'aborted' and disconnected. (socket: 12726) 20120326 03:45:05< tuxlobby> 20120326 03:45:05 Statistics: number_of_games = 1 number_of_users = 3 lobby_users = 0 20120326 03:45:28< lobby> vbs1997 ended game: "nome de vbs1997" (8448) at turn: 12 with reason: 'aborted'. (socket: 12771) 20120326 03:45:31< lobby> CircleJerker started game: "CircleJerker’s game" (8503) with: CircleJerker, TragicAce, Bashira. Settings: map: multiplayer_The_Royal_Rumble_Lavaville era: Ageless Era XP: 30 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 03:45:56< lobby> EternalGibbon ended game: "ChrisH’s game" (8495) at turn: 2 with reason: 'aborted'. (socket: 12834) 20120326 03:46:26< lobby> Atasco started game: "2on2 isars" (8516) with: Atasco, ChrisH, Zwirni, TsAK. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 03:46:37< lobby> ZeranSL ended game: "ZeranSL’s game" (8467) at turn: 10 with reason: 'aborted'. (socket: 12929) 20120326 03:46:50< lobby> Mogs started game: "Mogs’s game" (8515) with: Mogs. Settings: map: 3pSurvival era: era_heroes_magic_0.18.0 XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 03:47:24< dicplobby> 20120326 03:47:24 Statistics: number_of_games = 1 number_of_users = 3 lobby_users = 0 20120326 03:48:49< lobby> 20120326 03:48:49 Statistics: number_of_games = 44 number_of_users = 140 lobby_users = 29 20120326 03:48:54< lobby> Ikerpeta ended game: "Atasco’s game" (8456) at turn: 11 with reason: 'game over'. (socket: 12871) 20120326 03:49:34< lobby> Realeyz ended game: "amberj’s game" (8410) at turn: 14 with reason: 'aborted'. (socket: 12809) 20120326 03:49:39< lobby> Ikerpeta started game: "La partida de Ikerpeta" (8520) with: Ikerpeta. Settings: map: isars_blasphemy era: Ageless Era XP: 60 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 03:49:47< lobby> Peace out. 20120326 03:49:52< lobby> Imma go survival 20120326 03:50:05< tuxlobby> 20120326 03:50:05 Statistics: number_of_games = 1 number_of_users = 3 lobby_users = 0 20120326 03:50:11< lobby> Juliano started game: "La partida de Juliano" (8521) with: Juliano, gusti. Settings: map: 2vs2Survival era: era_default XP: 50 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 03:50:21< lobby> Ikerpeta ended game: "La partida de Ikerpeta" (8520) at turn: 1 with reason: 'aborted'. (socket: 12871) 20120326 03:50:31< lobby> zulu ended game: "1 vs 1, 3 heros each, RANDOM, 1 min per turn" (8282) at turn: 84 with reason: 'game over'. (socket: 12682) 20120326 03:50:35< lobby> Omnikinred started game: "Omnikinred’s game" (8522) with: Omnikinred. Settings: map: 3pSurvival era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 03:51:24< tuxlobby> Slaverzero has left game: "La partida de Slaverzero" (15322) and disconnected. (socket: 25221) 20120326 03:52:24< dicplobby> 20120326 03:52:24 Statistics: number_of_games = 1 number_of_users = 3 lobby_users = 0 20120326 03:53:49< lobby> 20120326 03:53:49 Statistics: number_of_games = 44 number_of_users = 140 lobby_users = 33 20120326 03:54:18< lobby> Conscience started game: "For Iker" (8524) with: Conscience, Ikerpeta. Settings: map: Conquest-Surdmark(teleports,long distances) era: Ageless RPG Era XP: 100 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 03:54:30< lobby> BrokenBones ended game: "La partida de Dhill" (8470) at turn: 16 with reason: 'aborted'. (socket: 12927) 20120326 03:54:38< lobby> Incomp ended game: "Irazel’s game" (8454) at turn: 15 with reason: 'game over'. (socket: 12858) 20120326 03:54:54< lobby> Seacet ended game: "nome de Seacet" (8219) at turn: 52 with reason: 'aborted'. (socket: 12495) 20120326 03:55:05< tuxlobby> 20120326 03:55:05 Statistics: number_of_games = 1 number_of_users = 2 lobby_users = 0 20120326 03:55:56< lobby> Dhill started game: "La partida de Dhill" (8523) with: Dhill, Diasporoz, essor, Ikerpeta1. Settings: map: multiplayer_Auction-X era: Ageless Era XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 03:56:43< lobby> Zeus ended game: "MCP’s game" (8468) at turn: 64 with reason: 'game over'. (socket: 12506) 20120326 03:57:11< lobby> Bamnshy started game: "Bamnshy’s game" (8526) with: Bamnshy, Maru, BasiC. Settings: map: TGQ_Scenario4_Snow era: era_default XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 03:57:24< dicplobby> 20120326 03:57:24 Statistics: number_of_games = 1 number_of_users = 3 lobby_users = 0 20120326 03:57:27< lobby> Ultron_Lives started game: "Ultron_Lives’s game" (8518) with: Ultron_Lives, Tobain, Narcissus-Pontius. Settings: map: TGQ_Scenario1_Homeland era: Ageless Era XP: 100 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 03:57:28< lobby> Mogs ended game: "Mogs’s game" (8515) at turn: 5 with reason: 'aborted'. (socket: 13007) 20120326 03:57:29< lobby> Ikerpeta1 ended game: "La partida de Dhill" (8523) at turn: 1 with reason: 'aborted'. (socket: 12924) 20120326 03:58:05< lobby> Bamnshy ended game: "Bamnshy’s game" (8526) at turn: 1 with reason: 'aborted'. (socket: 13037) 20120326 03:58:35< lobby> Bashira ended game: "CircleJerker’s game" (8503) at turn: 1 with reason: 'aborted'. (socket: 12907) 20120326 03:58:49< lobby> 20120326 03:58:49 Statistics: number_of_games = 39 number_of_users = 130 lobby_users = 29 20120326 03:58:51< lobby> BasiC started game: "BasiC’s game" (8528) with: BasiC, Bamnshy, Maru. Settings: map: TGQ_Scenario4_Snow era: TGQ_era XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 03:59:11< lobby> Dhill started game: "La partida de Dhill" (8527) with: Dhill, Diasporoz, BrokenBones, Ikerpeta1. Settings: map: multiplayer_Auction-X era: Ageless Era XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 03:59:38< lobby> Mogs started game: "Mogs’s game" (8529) with: Mogs. Settings: map: 2vs2Survival era: era_heroes_magic_0.18.0 XP: 100 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 03:59:49< lobby> platypus ended game: "platypus’s game" (8504) at turn: 6 with reason: 'game over'. (socket: 13003) 20120326 04:00:06< tuxlobby> 20120326 04:00:05 Statistics: number_of_games = 1 number_of_users = 2 lobby_users = 0 20120326 04:00:18< lobby> jhcordeiro ended game: "Juninho e' gay | Pau nele..." (8444) at turn: 12 with reason: 'game over'. (socket: 12759) 20120326 04:01:07< lobby> TC started game: "TC’s game" (8531) with: TC. Settings: map: multiplayer_Crusaders_Field era: Colosseum_Extended_era XP: 40 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 04:01:23< lobby> Tanorik ended game: "Tanorik’s game" (8430) at turn: 135 with reason: 'game over'. (socket: 12686) 20120326 04:01:27< lobby> TC ended game: "TC’s game" (8531) at turn: 1 with reason: 'aborted'. (socket: 13041) 20120326 04:01:57< lobby> Duris ended game: "boco’s game" (8490) at turn: 5 with reason: 'game over'. (socket: 12982) 20120326 04:02:09< lobby> Omnikinred ended game: "Omnikinred’s game" (8522) at turn: 15 with reason: 'aborted'. (socket: 13025) 20120326 04:02:24< dicplobby> 20120326 04:02:24 Statistics: number_of_games = 1 number_of_users = 3 lobby_users = 0 20120326 04:02:26< lobby> ZachAttack ended game: "ZachAttack’s game" (8505) at turn: 9 with reason: 'aborted'. (socket: 13006) 20120326 04:02:37< lobby> job started game: "job’s game" (8533) with: job, TheVeneGuy. Settings: map: multiplayer_The_Freelands era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 04:02:41< lobby> boco started game: "boco’s game" (8536) with: boco, Duris. Settings: map: elf_war_1_Broken_Pact_normal era: era_default XP: 100 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 04:03:13< lobby> TC started game: "TC’s game" (8537) with: TC. Settings: map: multiplayer_6p_Team_Survival era: Colosseum_Extended_era XP: 40 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 04:03:32< lobby> CastleCroquet ended game: "Heartbreakhero’s game" (8469) at turn: 14 with reason: 'game over'. (socket: 12948) 20120326 04:03:52< lobby> 20120326 04:03:52 Statistics: number_of_games = 36 number_of_users = 124 lobby_users = 30 20120326 04:04:17< lobby> TC ended game: "TC’s game" (8537) at turn: 2 with reason: 'aborted'. (socket: 13041) 20120326 04:04:42< lobby> dmr started game: "dmr’s game" (8534) with: dmr, TC. Settings: map: multiplayer_Hamlets era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 04:05:06< tuxlobby> 20120326 04:05:05 Statistics: number_of_games = 1 number_of_users = 2 lobby_users = 0 20120326 04:06:01< lobby> Mogs ended game: "Mogs’s game" (8529) at turn: 4 with reason: 'aborted'. (socket: 13007) 20120326 04:06:13< lobby> zaji970 ended game: "O-Nasan’s game" (8472) at turn: 7 with reason: 'aborted'. (socket: 12955) 20120326 04:06:50< lobby> Sir_Draco ended game: "Sir_Draco’s game" (8500) at turn: 6 with reason: 'aborted'. (socket: 12991) 20120326 04:07:11< lobby> 13arrage ended game: "13arrage’s game" (8502) at turn: 7 with reason: 'aborted'. (socket: 12993) 20120326 04:07:21< lobby> Beanbarian ended game: "Party platter by Druten " (8331) at turn: 81 with reason: 'game over'. (socket: 12750) 20120326 04:07:23< lobby> Tanorik started game: "Tanorik’s game" (8541) with: Tanorik. Settings: map: multiplayer_The_Freelands era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 04:07:24< dicplobby> 20120326 04:07:24 Statistics: number_of_games = 1 number_of_users = 3 lobby_users = 0 20120326 04:07:46< lobby> Scramrow started game: "Scramrow’s game" (8538) with: Scramrow, WarCry. Settings: map: (A New Land Classic)Aybabtu Valley era: (A New Land Classic)A New Land:Standard XP: 60 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 04:08:06< lobby> O-Nasan started game: "O-Nasan’s game" (8542) with: O-Nasan, zaji970. Settings: map: multiplayer_Siege_Castles era: era_default XP: 40 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 04:08:30< lobby> всем добрый день бля 20120326 04:08:52< lobby> 20120326 04:08:52 Statistics: number_of_games = 37 number_of_users = 122 lobby_users = 26 20120326 04:09:13< lobby> TwistedClock started game: "TwistedClock’s game" (8544) with: TwistedClock, kondor. Settings: map: multiplayer_Den_of_Onis era: era_default XP: 50 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 04:10:05< tuxlobby> 20120326 04:10:05 Statistics: number_of_games = 1 number_of_users = 2 lobby_users = 0 20120326 04:10:55< lobby> 13arrage started game: "13arrage’s game" (8543) with: 13arrage, Yarghenforgen, unban_dta. Settings: map: 3pSurvival era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 04:11:45< lobby> Kalyra started game: "La partida de Kalyra" (8546) with: Kalyra, Swiifty. Settings: map: vs_Survival_2p era: Dov_XP_Mod XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 04:12:24< dicplobby> 20120326 04:12:24 Statistics: number_of_games = 1 number_of_users = 3 lobby_users = 0 20120326 04:13:52< lobby> 20120326 04:13:52 Statistics: number_of_games = 37 number_of_users = 128 lobby_users = 27 20120326 04:15:05< tuxlobby> 20120326 04:15:05 Statistics: number_of_games = 1 number_of_users = 2 lobby_users = 0 20120326 04:17:07< lobby> Scramrow ended game: "Scramrow’s game" (8538) at turn: 5 with reason: 'aborted'. (socket: 13042) 20120326 04:17:24< dicplobby> 20120326 04:17:24 Statistics: number_of_games = 1 number_of_users = 3 lobby_users = 0 20120326 04:18:18< tuxlobby> kokis has logged off. (socket: 25223) 20120326 04:18:49< lobby> PAS ended game: "nome de kkk" (8492) at turn: 6 with reason: 'aborted'. (socket: 12968) 20120326 04:18:52< lobby> 20120326 04:18:52 Statistics: number_of_games = 35 number_of_users = 126 lobby_users = 31 20120326 04:18:58< tuxlobby> jugador ended game: "La partida de Slaverzero" (15322) at turn: 12 with reason: 'out of sync'. (socket: 25226) 20120326 04:19:07< tuxlobby> jugador has logged off. (socket: 25226) 20120326 04:20:05< tuxlobby> 20120326 04:20:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 04:20:18< lobby> Sioux started game: "nome de Sioux" (8545) with: Sioux, Macer, janizzz, Hakun, Scramrow, kkk. Settings: map: Colosseum_scenario era: Colosseum_Extended_era XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 04:21:50< lobby> BattleMaster advanced game: "Jeu de BattleMaster" (8361) with: BattleMaster, patriot. Settings: map: TL_WC_NM_Island4 era: XP: 80 GPV: fog: shroud: observers: shuffle: timer: 20120326 04:22:25< dicplobby> 20120326 04:22:24 Statistics: number_of_games = 1 number_of_users = 3 lobby_users = 0 20120326 04:23:52< lobby> 20120326 04:23:52 Statistics: number_of_games = 38 number_of_users = 122 lobby_users = 25 20120326 04:24:06< lobby> dmr ended game: "dmr’s game" (8534) at turn: 7 with reason: 'game over'. (socket: 13044) 20120326 04:24:25< lobby> Jaglavak ended game: "cupcake’s game RANDOM HERO ONLY" (8446) at turn: 29 with reason: 'aborted'. (socket: 12909) 20120326 04:25:05< tuxlobby> 20120326 04:25:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 04:25:22< lobby> Yarghenforgen ended game: "13arrage’s game" (8543) at turn: 4 with reason: 'aborted'. (socket: 12965) 20120326 04:26:55< lobby> An excellent day or night to all 20120326 04:27:01< lobby> u2 20120326 04:27:17< lobby> Atasco ended game: "2on2 isars" (8516) at turn: 11 with reason: 'game over'. (socket: 12661) 20120326 04:27:24< dicplobby> 20120326 04:27:24 Statistics: number_of_games = 1 number_of_users = 3 lobby_users = 0 20120326 04:27:43< lobby> ate amanhã! 20120326 04:27:46< lobby> até 20120326 04:27:49< lobby> <-Gomes-BR-> te+ 20120326 04:27:57< lobby> ja to com muito sono camaradas 20120326 04:28:05< lobby> <-Gomes-BR-> boa noite manin 20120326 04:28:08< lobby> SKS started game: "SKS’s game" (8552) with: SKS, Fuzzlewhack. Settings: map: multiplayer_2p_Dark_Forecast era: era_default XP: 100 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 04:28:08< lobby> Atasco started game: "2on2 isars" (8555) with: Atasco, ChrisH, 198pepe, Zwirni. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 04:28:09< lobby> boa noite e bom jogos ae pra vcs 20120326 04:28:10< lobby> hehehe 20120326 04:28:16< lobby> valeu pra ti tb 20120326 04:28:19< lobby> fui 20120326 04:28:20< lobby> <-Gomes-BR-> igualmente 20120326 04:28:26< lobby> pra min é bom sono 20120326 04:28:32< lobby> kkkkkkkkk 20120326 04:28:34< lobby> fui 20120326 04:28:38< lobby> cupcake started game: "cupcake’s game RANDOM HERO ONLY" (8550) with: cupcake, TC, screwtop, xor1337. Settings: map: Creep War New Map v0.2.6 era: Creep_Era XP: 60 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 04:28:52< lobby> 20120326 04:28:52 Statistics: number_of_games = 36 number_of_users = 122 lobby_users = 29 20120326 04:29:13< dicplobby> Et_Le_Cruel has logged off. (socket: 61) 20120326 04:29:20< dicplobby> papou has logged off. (socket: 60) 20120326 04:29:40< lobby> MrOrc ended game: "FilthyHobbit’s game" (8413) at turn: 17 with reason: 'game over'. (socket: 12857) 20120326 04:30:03< lobby> wrypage ended game: "wrypage’s game" (8230) at turn: 24 with reason: 'aborted'. (socket: 12631) 20120326 04:30:05< tuxlobby> 20120326 04:30:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 04:30:07< dicplobby> Simonstre ended game: "Jeu de Simonstre" (28) at turn: 8 with reason: 'game over'. (socket: 62) 20120326 04:30:11< dicplobby> Simonstre has logged off. (socket: 62) 20120326 04:30:45< lobby> 13arrage started game: "13arrage’s game" (8553) with: 13arrage, Yarghenforgen, unban_dta. Settings: map: 3pSurvival era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 04:30:54< lobby> mumma ended game: "cow的游戏" (8508) at turn: 9 with reason: 'aborted'. (socket: 12905) 20120326 04:32:24< dicplobby> 20120326 04:32:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 04:33:48< lobby> cow started game: "cow的游戏" (8559) with: cow, leandroroc. Settings: map: multiplayer_Basilisk era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 04:33:52< lobby> 20120326 04:33:52 Statistics: number_of_games = 35 number_of_users = 116 lobby_users = 28 20120326 04:35:05< tuxlobby> 20120326 04:35:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 04:35:07< lobby> Sisterz started game: "Jeu de Sisterz" (8561) with: Sisterz, LegioXIII. Settings: map: multiplayer_4p_Morituri era: era_heroes XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 04:35:14< lobby> job ended game: "job’s game" (8533) at turn: 12 with reason: 'game over'. (socket: 13038) 20120326 04:35:14< lobby> cptn_cool ended game: "cptn_cool’s game" (8347) at turn: 37 with reason: 'game over'. (socket: 12764) 20120326 04:35:36< lobby> Scramrow started game: "Scramrow’s game" (8560) with: Scramrow, TheVeneGuy, Gregor, TC. Settings: map: (A New Land Classic)Aybabtu Valley era: (A New Land Classic)A New Land:Standard XP: 60 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 04:36:42< lobby> DelphiniumandLoug ended game: "nome de LuizBR" (8491) at turn: 18 with reason: 'aborted' and disconnected. (socket: 12876) 20120326 04:37:24< dicplobby> 20120326 04:37:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 04:38:14< lobby> Grezdaed ended game: "Grezdaed’s game" (8425) at turn: 18 with reason: 'game over'. (socket: 12626) 20120326 04:38:38< lobby> mengluo started game: "Join?" (8557) with: mengluo, LuizBR. Settings: map: SXC_Chambers_0.2.98 era: Ageless RPG Era XP: 130 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 04:38:52< lobby> 20120326 04:38:52 Statistics: number_of_games = 37 number_of_users = 115 lobby_users = 26 20120326 04:39:00< lobby> Grezdaed started game: "Grezdaed’s game" (8565) with: Grezdaed, Orathoy. Settings: map: CSABI_The_Valley_of_the_Fear era: era_default XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 04:39:06< lobby> TwistedClock ended game: "TwistedClock’s game" (8544) at turn: 13 with reason: 'game over'. (socket: 13049) 20120326 04:39:22< lobby> kingjohn started game: "kingjohn’s game" (8563) with: kingjohn, KhorneFlakez. Settings: map: multiplayer_Blue_Water_Province era: era_default XP: 40 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 04:39:47< lobby> kingjohn ended game: "kingjohn’s game" (8563) at turn: 1 with reason: 'aborted'. (socket: 13086) 20120326 04:40:05< tuxlobby> 20120326 04:40:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 04:41:09< lobby> Tobain ended game: "Ultron_Lives’s game" (8518) at turn: 11 with reason: 'game over'. (socket: 12615) 20120326 04:41:28< lobby> xor1337 ended game: "cupcake’s game RANDOM HERO ONLY" (8550) at turn: 8 with reason: 'aborted'. (socket: 12888) 20120326 04:41:34< lobby> Miguel ended game: "2v2" (8476) at turn: 16 with reason: 'aborted'. (socket: 12819) 20120326 04:41:45< lobby> Kitoshide started game: "Kitoshide’s game" (8567) with: Kitoshide, ViralFerret. Settings: map: Colosseum_scenario era: Ageless Heroes XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 04:41:48< lobby> kondor started game: "Игра kondor" (8570) with: kondor, KhorneFlakez, kingjohn. Settings: map: multiplayer_3p_Morituri era: era_default XP: 30 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 04:41:57< lobby> Bare-havoc started game: "survive" (8564) with: Bare-havoc. Settings: map: 3pSurvival era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 04:42:18< lobby> TheCultHero ended game: "Kitoshide’s game" (8437) at turn: 18 with reason: 'aborted'. (socket: 12886) 20120326 04:42:18< lobby> Malik_Was_Here ended game: "Average" (8434) at turn: 38 with reason: 'game over'. (socket: 12808) 20120326 04:42:24< dicplobby> 20120326 04:42:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 04:43:13< lobby> Ultron_Lives started game: "Ultron_Lives’s game" (8569) with: Ultron_Lives, Narcissus-Pontius, Tobain. Settings: map: TGQ_Scenario1_Homeland era: Ageless Era XP: 100 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 04:43:44< lobby> cupcake started game: "cupcake’s game RANDOM HERO ONLY" (8562) with: cupcake, Hakuna, xor1337, jfitt. Settings: map: Creep War New Map v0.2.6 era: Creep_Era XP: 60 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 04:43:52< lobby> 20120326 04:43:52 Statistics: number_of_games = 33 number_of_users = 110 lobby_users = 28 20120326 04:44:29< lobby> Miguel started game: "La partida de Miguel" (8571) with: Miguel, cp9, Anagliptycus, Diasporoz. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 04:44:45< lobby> BattleMaster ended game: "Jeu de BattleMaster" (8361) at turn: 2 with reason: 'game over'. (socket: 12620) 20120326 04:45:05< tuxlobby> 20120326 04:45:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 04:45:35< lobby> Battleturtle started game: "Battleturtle’s game" (8572) with: Battleturtle, Ub3rP3nguin. Settings: map: user_map era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 04:47:25< dicplobby> 20120326 04:47:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 04:47:44< lobby> Battleturtle ended game: "Battleturtle’s game" (8572) at turn: 1 with reason: 'aborted'. (socket: 13097) 20120326 04:48:24< lobby> cow ended game: "cow的游戏" (8559) at turn: 6 with reason: 'aborted'. (socket: 12935) 20120326 04:48:52< lobby> 20120326 04:48:52 Statistics: number_of_games = 33 number_of_users = 113 lobby_users = 33 20120326 04:49:38< lobby> leandroroc started game: "La partida de leandroroc" (8575) with: leandroroc. Settings: map: multiplayer_Silverhead_Crossing era: era_heroes XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 04:50:05< tuxlobby> 20120326 04:50:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 04:50:10< lobby> Buroku3 ended game: "Ub3rPenguin’s game" (8501) at turn: 16 with reason: 'aborted'. (socket: 13000) 20120326 04:50:14< lobby> mjr started game: "mjr’s game" (8576) with: mjr, OlSalty, Atmohspheer, Zinnsoldat. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 04:52:04< lobby> Battleturtle started game: "Battleturtle’s game" (8577) with: Battleturtle, Ub3rPenguin, Buroku3, Wafa. Settings: map: user_map era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 04:52:24< dicplobby> 20120326 04:52:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 04:52:58< lobby> Buroku3 ended game: "Battleturtle’s game" (8577) at turn: 1 with reason: 'aborted'. (socket: 13000) 20120326 04:53:52< lobby> 20120326 04:53:52 Statistics: number_of_games = 33 number_of_users = 113 lobby_users = 26 20120326 04:54:06< lobby> Battleturtle started game: "Battleturtle’s game" (8578) with: Battleturtle, Buroku3, Wafa, Ub3rPenguin. Settings: map: user_map era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 04:54:26< lobby> Minion ended game: "Minion’s game" (8453) at turn: 18 with reason: 'game over'. (socket: 12902) 20120326 04:54:46< lobby> well who is hosting? 20120326 04:55:05< tuxlobby> 20120326 04:55:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 04:55:46< lobby> leandroroc ended game: "La partida de leandroroc" (8575) at turn: 6 with reason: 'aborted'. (socket: 13081) 20120326 04:57:24< dicplobby> 20120326 04:57:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 04:57:30< lobby> BrokenBones ended game: "La partida de Dhill" (8527) at turn: 9 with reason: 'aborted' and disconnected. (socket: 12927) 20120326 04:57:52< lobby> Sisterz ended game: "Jeu de Sisterz" (8561) at turn: 11 with reason: 'game over'. (socket: 13082) 20120326 04:58:44< lobby> CenetaurmanE52 started game: "Led by a champion. [Reserved]" (8579) with: CenetaurmanE52, NightMagus, Minion. Settings: map: World_Conquest_Start era: Ageless Heroes XP: 80 GPV: fog: shroud: observers: no shuffle: yes timer: 20120326 04:58:52< lobby> 20120326 04:58:52 Statistics: number_of_games = 30 number_of_users = 108 lobby_users = 30 20120326 04:59:38< lobby> job started game: "job’s game" (8581) with: job, Jurgen. Settings: map: multiplayer_The_Freelands era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 05:00:05< tuxlobby> 20120326 05:00:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 05:00:31< lobby> job ended game: "job’s game" (8581) at turn: 1 with reason: 'aborted'. (socket: 13038) 20120326 05:01:13< lobby> job started game: "job’s game" (8583) with: job, Jurgen. Settings: map: multiplayer_The_Freelands era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 05:02:24< dicplobby> 20120326 05:02:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 05:03:51< lobby> po started game: "po のゲーム" (8585) with: po, Ikerpeta1. Settings: map: isars_blasphemy era: Ageless Era XP: 60 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 05:03:52< lobby> 20120326 05:03:52 Statistics: number_of_games = 33 number_of_users = 111 lobby_users = 30 20120326 05:04:18< lobby> mjr ended game: "mjr’s game" (8576) at turn: 5 with reason: 'aborted'. (socket: 13107) 20120326 05:04:55< lobby> mjr started game: "mjr’s game" (8586) with: mjr, Atmohspheer, Reimu, Zinnsoldat. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 05:05:00< lobby> Drakevarg started game: "Drake's Game" (8584) with: Drakevarg, Rovolloth. Settings: map: multiplayer_Cynsaun_Battlefield era: era_default XP: 50 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 05:05:05< tuxlobby> 20120326 05:05:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 05:05:29< lobby> Estagar ended game: "Estagar’s game - 150 timer" (8474) at turn: 32 with reason: 'game over'. (socket: 12959) 20120326 05:06:33< lobby> Playa ended game: "clap’s game" (8443) at turn: 16 with reason: 'aborted'. (socket: 12901) 20120326 05:07:06< lobby> Lary ended game: "Battleturtle’s game" (8578) at turn: 4 with reason: 'aborted'. (socket: 13121) 20120326 05:07:09< lobby> Anagliptycus ended game: "La partida de Miguel" (8571) at turn: 7 with reason: 'aborted'. (socket: 13094) 20120326 05:07:22< lobby> ExarKun ended game: "Zagz’s game" (8498) at turn: 14 with reason: 'game over'. (socket: 12816) 20120326 05:07:24< dicplobby> 20120326 05:07:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 05:07:38< lobby> Tanorik ended game: "Tanorik’s game" (8541) at turn: 130 with reason: 'game over'. (socket: 12686) 20120326 05:08:36< lobby> Kalyra ended game: "La partida de Kalyra" (8546) at turn: 20 with reason: 'aborted'. (socket: 13051) 20120326 05:08:52< lobby> 20120326 05:08:52 Statistics: number_of_games = 26 number_of_users = 95 lobby_users = 30 20120326 05:10:05< tuxlobby> 20120326 05:10:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 05:10:21< lobby> Tobain ended game: "Ultron_Lives’s game" (8569) at turn: 7 with reason: 'aborted'. (socket: 12615) 20120326 05:10:29< lobby> OlSalty started game: "OlSalty’s game" (8588) with: OlSalty, soyvirgen, Anagliptycus, Hakuna. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 05:11:04< lobby> TwistedClock started game: "TwistedClock’s game" (8587) with: TwistedClock, Limabean. Settings: map: multiplayer_Den_of_Onis era: era_default XP: 50 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 05:11:21< lobby> Rovolloth ended game: "Drake's Game" (8584) at turn: 4 with reason: 'aborted'. (socket: 13118) 20120326 05:11:22< lobby> Ultron_Lives started game: "Ultron_Lives’s game" (8589) with: Ultron_Lives, Tobain, Narcissus-Pontius. Settings: map: TGQ_Scenario1_Homeland era: Ageless Era XP: 100 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 05:12:25< dicplobby> 20120326 05:12:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 05:13:34< lobby> Jormundgandr started game: "Jormundgandr’s game" (8590) with: Jormundgandr. Settings: map: multiplayer_Random_Map era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 05:13:52< lobby> 20120326 05:13:52 Statistics: number_of_games = 29 number_of_users = 94 lobby_users = 25 20120326 05:15:05< tuxlobby> 20120326 05:15:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 05:15:13< lobby> Jormundgandr ended game: "Jormundgandr’s game" (8590) at turn: 1 with reason: 'aborted'. (socket: 12820) 20120326 05:16:37< lobby> 2v2 open 20120326 05:16:47< lobby> bruisehound ended game: "Bulg’s game" (8484) at turn: 16 with reason: 'game over'. (socket: 12988) 20120326 05:17:24< dicplobby> 20120326 05:17:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 05:17:43< lobby> Charmander started game: "go hf 2 min." (8593) with: Charmander, SKS, Madmoo, bossman. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 05:18:13< lobby> anyone want to play? 20120326 05:18:52< lobby> 20120326 05:18:52 Statistics: number_of_games = 28 number_of_users = 93 lobby_users = 26 20120326 05:19:45< lobby> ArmOrAttAk started game: "ArmOrAttAk’s game" (8595) with: ArmOrAttAk, chocoboner, Hakun, tadpol. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 05:20:06< tuxlobby> 20120326 05:20:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 05:21:16< lobby> Bare-havoc ended game: "survive" (8564) at turn: 23 with reason: 'aborted'. (socket: 12219) 20120326 05:21:45< lobby> kurono ended game: "La partida de kurono" (8461) at turn: 46 with reason: 'game over'. (socket: 12920) 20120326 05:22:24< dicplobby> 20120326 05:22:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 05:22:50< lobby> mjr ended game: "mjr’s game" (8586) at turn: 6 with reason: 'aborted'. (socket: 13107) 20120326 05:23:33< lobby> po ended game: "po のゲーム" (8585) at turn: 11 with reason: 'aborted'. (socket: 13115) 20120326 05:23:52< lobby> 20120326 05:23:52 Statistics: number_of_games = 25 number_of_users = 90 lobby_users = 28 20120326 05:25:03< lobby> mjr started game: "mjr’s game" (8596) with: mjr, Atmohspheer, Reimu, po. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 05:25:06< tuxlobby> 20120326 05:25:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 05:26:42< lobby> Minion ended game: "Led by a champion. [Reserved]" (8579) at turn: 1 with reason: 'aborted'. (socket: 12902) 20120326 05:27:24< dicplobby> 20120326 05:27:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 05:28:10< lobby> CenetaurmanE52 started game: "Only complete dumbasses allow observers. [Reserved] [Observers allowed]" (8599) with: CenetaurmanE52, Minion, NightMagus. Settings: map: World_Conquest_Start era: Ageless Heroes XP: 80 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 05:28:52< lobby> 20120326 05:28:52 Statistics: number_of_games = 27 number_of_users = 89 lobby_users = 23 20120326 05:29:04< lobby> Charmander started game: "go gl" (8601) with: Charmander, Madmoo, shockrunner. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 05:29:35< lobby> Bare-havoc started game: "Bare-havoc’s game" (8598) with: Bare-havoc. Settings: map: 3pSurvival era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 05:30:05< tuxlobby> 20120326 05:30:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 05:31:59< lobby> ChrisH ended game: "2on2 isars" (8555) at turn: 14 with reason: 'game over'. (socket: 12132) 20120326 05:32:12< lobby> very well 20120326 05:32:13< lobby> Scramrow ended game: "Scramrow’s game" (8560) at turn: 11 with reason: 'aborted'. (socket: 13042) 20120326 05:32:15< lobby> u win 20120326 05:32:19< lobby> yes 20120326 05:32:20< lobby> :x 20120326 05:32:24< dicplobby> 20120326 05:32:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 05:32:31< lobby> not a single lvl2 unit though :( 20120326 05:32:41< lobby> u have a warrior 20120326 05:32:49< lobby> ah true 20120326 05:32:51< lobby> and he is alive 20120326 05:32:56< lobby> ok then 20120326 05:33:52< lobby> 20120326 05:33:52 Statistics: number_of_games = 27 number_of_users = 90 lobby_users = 27 20120326 05:33:53< lobby> TheVeneGuy started game: "TheVeneGuy’s game" (8604) with: TheVeneGuy, Atasco. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 05:34:08< lobby> TheVeneGuy ended game: "TheVeneGuy’s game" (8604) at turn: 1 with reason: 'aborted'. (socket: 13005) 20120326 05:35:00< lobby> Atasco started game: "2on2 isars" (8606) with: Atasco, Zwirni, AxalaraFlame, bossman. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 05:35:05< tuxlobby> 20120326 05:35:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 05:36:40< lobby> :o 20120326 05:36:46< lobby> kingjohn started game: "kingjohn’s game" (8608) with: kingjohn, KhorneFlakez. Settings: map: multiplayer_Basilisk era: era_default XP: 40 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 05:37:03< lobby> game anyone ? 20120326 05:37:13< lobby> kondor ended game: "Игра kondor" (8570) at turn: 15 with reason: 'aborted'. (socket: 13050) 20120326 05:37:25< dicplobby> 20120326 05:37:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 05:37:28< tuxlobby> James has logged on. (socket: 25227) 20120326 05:37:45< lobby> TheVeneGuy started game: "TheVeneGuy’s game" (8605) with: TheVeneGuy, Miguel, jschmidtBR, xivarmy. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 05:37:57< lobby> orocia :) 20120326 05:38:00< tuxlobby> James has logged off. (socket: 25227) 20120326 05:38:28< lobby> SKS ended game: "go hf 2 min." (8593) at turn: 3 with reason: 'aborted' and disconnected. (socket: 13135) 20120326 05:38:52< lobby> 20120326 05:38:52 Statistics: number_of_games = 28 number_of_users = 89 lobby_users = 23 20120326 05:40:05< tuxlobby> 20120326 05:40:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 05:40:17< lobby> Legolas95 ended game: "Legolas95’s game" (8414) at turn: 11 with reason: 'aborted'. (socket: 12784) 20120326 05:41:24< lobby> Durr started game: "Durr’s game" (8611) with: Durr, WarDuck. Settings: map: multiplayer_Waterloo_Sunset era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 05:42:24< dicplobby> 20120326 05:42:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 05:42:57< lobby> DroppedConnection started game: "DroppedConnection’s game" (8610) with: DroppedConnection, goldfrog, ukian. Settings: map: Dov_MP_Orocia era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 05:43:52< lobby> 20120326 05:43:52 Statistics: number_of_games = 29 number_of_users = 84 lobby_users = 22 20120326 05:45:05< tuxlobby> 20120326 05:45:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 05:45:30< lobby> Reimu ended game: "mjr’s game" (8596) at turn: 7 with reason: 'game over'. (socket: 13124) 20120326 05:45:33< lobby> xivarmy ended game: "TheVeneGuy’s game" (8605) at turn: 4 with reason: 'aborted'. (socket: 13147) 20120326 05:45:35< lobby> coledmin started game: "coledmin’s game" (8612) with: coledmin, shockrunner. Settings: map: multiplayer_Clash era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 05:45:48< lobby> mjr started game: "mjr’s game" (8614) with: mjr, Reimu, TheVeneGuy, Miguel. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 05:46:28< lobby> xivarmy started game: "xivarmy’s game" (8616) with: xivarmy, Atmohspheer. Settings: map: multiplayer_Den_of_Onis era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 05:46:44< lobby> shockrunner ended game: "coledmin’s game" (8612) at turn: 1 with reason: 'aborted'. (socket: 13161) 20120326 05:47:21< lobby> NightMagus ended game: "Only complete dumbasses allow observers. [Reserved] [Observers allowed]" (8599) at turn: 4 with reason: 'aborted'. (socket: 13113) 20120326 05:47:21< lobby> coledmin started game: "coledmin’s game" (8617) with: coledmin, shockrunner. Settings: map: multiplayer_Clash era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 05:47:24< dicplobby> 20120326 05:47:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 05:47:33< lobby> off we go again gents 20120326 05:47:44< lobby> it's like giving a ninja a magnetic katana vs a guy in steal armor. 20120326 05:47:48< lobby> steel* 20120326 05:47:49< lobby> jeez 20120326 05:48:41< lobby> lol 20120326 05:48:50< lobby> Charmander ended game: "go gl" (8601) at turn: 6 with reason: 'aborted'. (socket: 13133) 20120326 05:48:52< lobby> 20120326 05:48:52 Statistics: number_of_games = 28 number_of_users = 85 lobby_users = 23 20120326 05:49:01< lobby> boco advanced game: "boco’s game" (8536) with: boco, Duris. Settings: map: elf_war_2_The_Battle_of_Vesna_Valley_normal era: XP: 100 GPV: fog: shroud: observers: shuffle: timer: 20120326 05:49:14< lobby> any survival? 20120326 05:49:26< lobby> CenetaurmanE52 started game: "Quack. [Reserved]" (8618) with: CenetaurmanE52, NightMagus, Minion. Settings: map: World_Conquest_Start era: Ageless Era XP: 80 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 05:50:05< tuxlobby> 20120326 05:50:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 05:50:10< lobby> Limabean ended game: "TwistedClock’s game" (8587) at turn: 17 with reason: 'game over'. (socket: 13092) 20120326 05:51:29< lobby> Charmander started game: "gl hf" (8619) with: Charmander, Flarix, Madmoo. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 05:52:24< dicplobby> 20120326 05:52:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 05:53:34< lobby> Duris ended game: "boco’s game" (8536) at turn: 1 with reason: 'game over'. (socket: 12982) 20120326 05:53:52< lobby> 20120326 05:53:52 Statistics: number_of_games = 28 number_of_users = 86 lobby_users = 22 20120326 05:54:18< lobby> boco started game: "boco’s game" (8621) with: boco, Duris. Settings: map: elf_war_2_The_Battle_of_Vesna_Valley_normal era: era_default XP: GPV: fog: shroud: observers: no shuffle: no timer: 20120326 05:55:05< tuxlobby> 20120326 05:55:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 05:56:41< lobby> job ended game: "job’s game" (8583) at turn: 18 with reason: 'game over'. (socket: 13038) 20120326 05:56:56< lobby> Duris ended game: "boco’s game" (8621) at turn: 1 with reason: 'out of sync'. (socket: 12982) 20120326 05:57:07< lobby> boco started game: "boco’s game" (8624) with: boco, Duris. Settings: map: elf_war_2_The_Battle_of_Vesna_Valley_normal era: era_default XP: GPV: fog: shroud: observers: no shuffle: no timer: 20120326 05:57:24< dicplobby> 20120326 05:57:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 05:58:01< lobby> chocoboner started game: "chocoboner’s game" (8622) with: chocoboner, Narcissus-Pontius. Settings: map: user_map era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 05:58:13< lobby> SKS started game: "SKS’s game" (8623) with: SKS, JomskyPonsky. Settings: map: multiplayer_2p_Dark_Forecast era: era_default XP: 100 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 05:58:52< lobby> 20120326 05:58:52 Statistics: number_of_games = 29 number_of_users = 86 lobby_users = 21 20120326 06:00:05< tuxlobby> 20120326 06:00:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 06:01:22< lobby> O-Nasan ended game: "O-Nasan’s game" (8542) at turn: 13 with reason: 'aborted'. (socket: 12954) 20120326 06:02:25< dicplobby> 20120326 06:02:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 06:03:22< lobby> cow started game: "cow的游戏" (8627) with: cow, job. Settings: map: multiplayer_Basilisk era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 06:03:52< lobby> 20120326 06:03:52 Statistics: number_of_games = 29 number_of_users = 82 lobby_users = 19 20120326 06:04:00< lobby> Jurgen started game: "Era of Myths" (8626) with: Jurgen. Settings: map: multiplayer_Isars_Cross era: era_EOM_5.10.0 svn XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 06:05:05< tuxlobby> 20120326 06:05:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 06:05:49< lobby> Minion ended game: "Quack. [Reserved]" (8618) at turn: 1 with reason: 'aborted' and disconnected. (socket: 12902) 20120326 06:06:03< lobby> Madmoo ended game: "gl hf" (8619) at turn: 5 with reason: 'aborted'. (socket: 13136) 20120326 06:06:31< lobby> ArmOrAttAk ended game: "ArmOrAttAk’s game" (8595) at turn: 19 with reason: 'game over'. (socket: 13139) 20120326 06:06:57< lobby> ...? 20120326 06:07:01< lobby> xivarmy ended game: "xivarmy’s game" (8616) at turn: 14 with reason: 'game over'. (socket: 13147) 20120326 06:07:24< dicplobby> 20120326 06:07:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 06:07:40< lobby> MAHAHAHA 20120326 06:08:52< lobby> 20120326 06:08:52 Statistics: number_of_games = 28 number_of_users = 84 lobby_users = 24 20120326 06:09:09< lobby> ViralFerret ended game: "Kitoshide’s game" (8567) at turn: 48 with reason: 'game over'. (socket: 12875) 20120326 06:09:50< lobby> Minion started game: "Oranges, Impecable Oranges (Reserved)" (8631) with: Minion, CenetaurmanE52, NightMagus. Settings: map: 3pSurvival era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 06:10:05< tuxlobby> 20120326 06:10:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 06:10:09< lobby> Flarix started game: "Flarix’s game" (8629) with: Flarix, Madmoo, ArmOrAttAk, Griffon. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 06:10:56< lobby> Megamuffins started game: "Megamuffins’s game" (8634) with: Megamuffins, Lucaness, Random_Man92, Tanorik. Settings: map: multiplayer_Random_Map era: era_default XP: 100 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 06:11:23< lobby> Ikerpeta started game: "La partida de Ikerpeta" (8635) with: Ikerpeta, Conscience. Settings: map: Conquest-Surdmark(teleports,long distances) era: Ageless RPG Era XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 06:12:24< dicplobby> 20120326 06:12:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 06:12:35< lobby> shockrunner ended game: "coledmin’s game" (8617) at turn: 10 with reason: 'game over'. (socket: 13161) 20120326 06:12:59< lobby> Jurgen ended game: "Era of Myths" (8626) at turn: 4 with reason: 'aborted'. (socket: 13170) 20120326 06:13:52< lobby> 20120326 06:13:52 Statistics: number_of_games = 29 number_of_users = 82 lobby_users = 17 20120326 06:13:54< lobby> OlSalty ended game: "OlSalty’s game" (8588) at turn: 11 with reason: 'game over'. (socket: 13103) 20120326 06:13:55< lobby> Kitoshide started game: "Kitoshide’s game" (8633) with: Kitoshide, ViralFerret. Settings: map: multiplayer_Auction-X era: Ageless Era XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 06:13:56< lobby> KhorneFlakez ended game: "kingjohn’s game" (8608) at turn: 18 with reason: 'game over'. (socket: 13079) 20120326 06:14:25< lobby> Jurgen started game: "La partida de Jurgen" (8636) with: Jurgen. Settings: map: multiplayer_Basilisk era: era_EOM_5.10.0 svn XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 06:14:30< lobby> Ultron_Lives advanced game: "Ultron_Lives’s game" (8589) with: Ultron_Lives, Tobain. Settings: map: TGQ_Scenario2_Sand era: XP: 100 GPV: fog: shroud: observers: shuffle: timer: 20120326 06:15:05< tuxlobby> 20120326 06:15:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 06:15:44< lobby> gusti ended game: "La partida de Juliano" (8521) at turn: 23 with reason: 'game over'. (socket: 13024) 20120326 06:16:32< lobby> unban_dta ended game: "13arrage’s game" (8553) at turn: 23 with reason: 'aborted'. (socket: 13002) 20120326 06:16:51< lobby> creep war, somebody? 20120326 06:17:24< dicplobby> 20120326 06:17:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 06:18:45< lobby> OlSalty started game: "OlSalty’s game" (8637) with: OlSalty, Hakun, Middigit212, Charmander. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 06:18:48< lobby> JomskyPonsky ended game: "SKS’s game" (8623) at turn: 12 with reason: 'aborted'. (socket: 13167) 20120326 06:18:52< lobby> 20120326 06:18:52 Statistics: number_of_games = 25 number_of_users = 78 lobby_users = 22 20120326 06:19:03< lobby> SKS started game: "SKS’s game" (8638) with: SKS, JomskyPonsky. Settings: map: multiplayer_2p_Dark_Forecast era: era_default XP: 100 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 06:20:05< tuxlobby> 20120326 06:20:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 06:22:24< dicplobby> 20120326 06:22:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 06:23:52< lobby> 20120326 06:23:52 Statistics: number_of_games = 25 number_of_users = 77 lobby_users = 22 20120326 06:25:05< tuxlobby> 20120326 06:25:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 06:25:13< lobby> Orathoy ended game: "Grezdaed’s game" (8565) at turn: 32 with reason: 'aborted'. (socket: 13090) 20120326 06:26:06< lobby> AxalaraFlame started game: "AxalaraFlame’s game" (8640) with: AxalaraFlame, Atasco. Settings: map: multiplayer_Den_of_Onis era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 06:27:19< lobby> TheVeneGuy ended game: "mjr’s game" (8614) at turn: 12 with reason: 'game over'. (socket: 13005) 20120326 06:27:22< lobby> SKS ended game: "SKS’s game" (8638) at turn: 4 with reason: 'aborted' and disconnected. (socket: 13162) 20120326 06:27:25< dicplobby> 20120326 06:27:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 06:27:37< lobby> Jurgen ended game: "La partida de Jurgen" (8636) at turn: 6 with reason: 'game over'. (socket: 13170) 20120326 06:28:16< lobby> bluewolf27 started game: "bluewolf27’s game" (8641) with: bluewolf27, MsEdyn. Settings: map: multiplayer_Paths_of_Daggers era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 06:28:39< lobby> MsEdyn ended game: "bluewolf27’s game" (8641) at turn: 1 with reason: 'aborted'. (socket: 13189) 20120326 06:28:47< lobby> janizzz ended game: "nome de Sioux" (8545) at turn: 48 with reason: 'aborted' and disconnected. (socket: 13062) 20120326 06:28:52< lobby> 20120326 06:28:52 Statistics: number_of_games = 25 number_of_users = 79 lobby_users = 23 20120326 06:29:48< lobby> bluewolf27 started game: "bluewolf27’s game" (8645) with: bluewolf27, MsEdyn. Settings: map: multiplayer_Paths_of_Daggers era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 06:30:05< tuxlobby> 20120326 06:30:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 06:30:23< lobby> Grezdaed started game: "Grezdaed’s game" (8644) with: Grezdaed, Orathoy, Nohgoa. Settings: map: TGQ_Scenario1_Homeland era: era_default XP: 100 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 06:31:28< lobby> JomskyPonsky started game: "La partida de JomskyPonsky" (8646) with: JomskyPonsky. Settings: map: ice era: era_AME XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 06:31:56< lobby> LuizBR ended game: "Join?" (8557) at turn: 45 with reason: 'aborted' and disconnected. (socket: 12979) 20120326 06:32:13< lobby> JomskyPonsky ended game: "La partida de JomskyPonsky" (8646) at turn: 1 with reason: 'aborted'. (socket: 13167) 20120326 06:32:13< lobby> r-Cos_Theta_2 started game: "r-Cos_Theta_2’s game" (8642) with: r-Cos_Theta_2, Dashzed, platypus, tadpol. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 06:32:24< dicplobby> 20120326 06:32:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 06:33:52< lobby> 20120326 06:33:52 Statistics: number_of_games = 23 number_of_users = 82 lobby_users = 22 20120326 06:35:05< tuxlobby> 20120326 06:35:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 06:35:56< lobby> Ikerpeta ended game: "La partida de Ikerpeta" (8635) at turn: 12 with reason: 'aborted'. (socket: 12871) 20120326 06:37:24< dicplobby> 20120326 06:37:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 06:38:52< lobby> 20120326 06:38:52 Statistics: number_of_games = 22 number_of_users = 79 lobby_users = 23 20120326 06:39:19< lobby> Narcissus-Pontius ended game: "chocoboner’s game" (8622) at turn: 12 with reason: 'aborted'. (socket: 13031) 20120326 06:40:05< tuxlobby> 20120326 06:40:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 06:41:10< lobby> bossman ended game: "2on2 isars" (8606) at turn: 18 with reason: 'game over'. (socket: 13116) 20120326 06:42:24< dicplobby> 20120326 06:42:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 06:43:38< lobby> ArmOrAttAk started game: "ArmOrAttAk’s game" (8651) with: ArmOrAttAk, brandonly, abhijit, pfgtre. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 06:43:52< lobby> 20120326 06:43:52 Statistics: number_of_games = 24 number_of_users = 79 lobby_users = 18 20120326 06:45:05< tuxlobby> 20120326 06:45:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 06:47:24< dicplobby> 20120326 06:47:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 06:48:57< lobby> 20120326 06:48:57 Statistics: number_of_games = 24 number_of_users = 84 lobby_users = 25 20120326 06:49:13< lobby> boco advanced game: "boco’s game" (8624) with: boco, Duris. Settings: map: elf_war_3_Inside_the_Mountain_normal era: XP: 100 GPV: fog: shroud: observers: shuffle: timer: 20120326 06:49:48< lobby> neila ended game: "For Iker" (8524) at turn: 11 with reason: 'aborted'. (socket: 13112) 20120326 06:50:06< tuxlobby> 20120326 06:50:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 06:50:34< lobby> Anyone up for dark forcast? 20120326 06:50:43< lobby> what's that? 20120326 06:50:48< lobby> 2 player survival 20120326 06:50:59< lobby> it can be hard for 1st timers 20120326 06:51:03< lobby> co-op? 20120326 06:51:05< lobby> yes 20120326 06:51:15< lobby> i've never played, but i'm down 20120326 06:51:23< lobby> cool 20120326 06:51:36< lobby> Cessna started game: "Cessna’s game RANDOM" (8654) with: Cessna, Fungy, kirin, RickDangerous. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 06:51:48< lobby> xor1337 ended game: "cupcake’s game RANDOM HERO ONLY" (8562) at turn: 49 with reason: 'game over'. (socket: 12888) 20120326 06:52:02< lobby> how do i enter your game? 20120326 06:52:25< dicplobby> 20120326 06:52:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 06:53:56< lobby> tadpol ended game: "r-Cos_Theta_2’s game" (8642) at turn: 5 with reason: 'aborted'. (socket: 13122) 20120326 06:53:57< lobby> 20120326 06:53:57 Statistics: number_of_games = 20 number_of_users = 85 lobby_users = 35 20120326 06:55:06< tuxlobby> 20120326 06:55:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 06:56:39< lobby> platypus started game: "platypus’s game" (8657) with: platypus, x4ro. Settings: map: multiplayer_Basilisk era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 06:57:07< lobby> anyone up for some creep wars? 20120326 06:57:24< dicplobby> 20120326 06:57:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 06:58:00< lobby> Tobain ended game: "Ultron_Lives’s game" (8589) at turn: 7 with reason: 'game over'. (socket: 12615) 20120326 06:58:34< lobby> Duris ended game: "boco’s game" (8624) at turn: 3 with reason: 'game over'. (socket: 12982) 20120326 06:58:34< lobby> Direwolf1 started game: "Direwolf1’s game" (8660) with: Direwolf1, cupcake. Settings: map: multiplayer_2p_Dark_Forecast era: Ageless Era XP: 100 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 06:58:54< lobby> boco started game: "boco’s game" (8662) with: boco, Duris. Settings: map: elf_war_3_Inside_the_Mountain_normal era: era_default XP: GPV: fog: shroud: observers: no shuffle: no timer: 20120326 06:58:57< lobby> 20120326 06:58:57 Statistics: number_of_games = 24 number_of_users = 84 lobby_users = 25 20120326 06:59:14< lobby> priya91 started game: "priya91’s game" (8659) with: priya91, psweet. Settings: map: multiplayer_4p_Hamlets era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 07:00:05< tuxlobby> 20120326 07:00:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 07:00:52< lobby> cow ended game: "cow的游戏" (8627) at turn: 13 with reason: 'aborted'. (socket: 13169) 20120326 07:00:56< lobby> Godwalking started game: "Godwalking’s game" (8663) with: Godwalking, Gliden. Settings: map: multiplayer_Howling_Ghost_Badlands era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 07:01:47< lobby> Duris ended game: "boco’s game" (8662) at turn: 3 with reason: 'aborted'. (socket: 12982) 20120326 07:02:05< lobby> boco started game: "boco’s game" (8666) with: boco, Duris. Settings: map: elf_war_3_Inside_the_Mountain_normal era: era_default XP: GPV: fog: shroud: observers: no shuffle: no timer: 20120326 07:02:21< lobby> boco ended game: "boco’s game" (8666) at turn: 1 with reason: 'aborted'. (socket: 12980) 20120326 07:02:24< dicplobby> 20120326 07:02:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 07:02:43< lobby> Beanbarian started game: "Bollywood Live, starring Joe, Helen, and Wendy!" (8658) with: Beanbarian, Wagolita. Settings: map: user_map era: era_default XP: 50 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 07:02:52< lobby> boco started game: "boco’s game" (8667) with: boco, Duris. Settings: map: elf_war_3_Inside_the_Mountain_normal era: era_default XP: GPV: fog: shroud: observers: no shuffle: no timer: 20120326 07:03:54< lobby> Sanctity started game: "Sanctity’s game" (8664) with: Sanctity, Nitetrip. Settings: map: multiplayer_Xanthe_Chaos era: era_default XP: 200 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 07:03:58< lobby> 20120326 07:03:58 Statistics: number_of_games = 24 number_of_users = 87 lobby_users = 28 20120326 07:04:16< lobby> Sanctity ended game: "Sanctity’s game" (8664) at turn: 1 with reason: 'aborted'. (socket: 13206) 20120326 07:04:24< lobby> cow started game: "cow的游戏" (8669) with: cow, nikahn. Settings: map: multiplayer_Basilisk era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 07:05:05< tuxlobby> 20120326 07:05:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 07:06:44< lobby> Ultron_Lives started game: "Ultron_Lives’s game" (8668) with: Ultron_Lives, JomskyPonsky. Settings: map: ice era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 07:07:08< lobby> Sanctity started game: "Sanctity’s game" (8670) with: Sanctity, Nitetrip. Settings: map: multiplayer_Isars_Cross era: era_default XP: 200 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 07:07:16< lobby> Direwolf1 ended game: "Direwolf1’s game" (8660) at turn: 5 with reason: 'aborted'. (socket: 13225) 20120326 07:07:24< dicplobby> 20120326 07:07:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 07:07:41< lobby> Riger started game: "Riger’s game" (8671) with: Riger, Kaine, Mister_Cuddles, Vulpix. Settings: map: multiplayer_Random_Map era: era_default XP: 80 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 07:08:16< lobby> WarDuck ended game: "Durr’s game" (8611) at turn: 23 with reason: 'game over'. (socket: 13160) 20120326 07:08:39< lobby> Direwolf1 started game: "Direwolf1’s game" (8673) with: Direwolf1, cupcake. Settings: map: multiplayer_2p_Dark_Forecast era: Ageless Era XP: 100 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 07:08:58< lobby> 20120326 07:08:58 Statistics: number_of_games = 29 number_of_users = 90 lobby_users = 21 20120326 07:09:08< lobby> solarheinous started game: "solarheinous’s game" (8672) with: solarheinous, cp9, kuruption. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 07:09:24< lobby> JomskyPonsky ended game: "Ultron_Lives’s game" (8668) at turn: 1 with reason: 'aborted'. (socket: 13167) 20120326 07:09:33< lobby> cp9 ended game: "solarheinous’s game" (8672) at turn: 1 with reason: 'aborted'. (socket: 13236) 20120326 07:09:59< lobby> Ultron_Lives started game: "Ultron_Lives’s game" (8675) with: Ultron_Lives, Narcissus-Pontius, JomskyPonsky. Settings: map: Dov_MP_Orocia era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 07:10:05< tuxlobby> 20120326 07:10:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 07:11:09< lobby> Durr started game: "Durr’s game" (8676) with: Durr, WarDuck. Settings: map: multiplayer_Ruins_of_Terra-Dwelve era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 07:12:24< dicplobby> 20120326 07:12:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 07:12:47< lobby> mjr started game: "mjr’s game" (8677) with: mjr, r-Cos_Theta_2, thefish, SLAVA1. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 07:12:56< lobby> deviouschild started game: "deviouschild’s game" (8678) with: deviouschild. Settings: map: TT_01_attack_to_elf_city era: era_heroes XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 07:13:58< lobby> 20120326 07:13:58 Statistics: number_of_games = 28 number_of_users = 92 lobby_users = 22 20120326 07:14:21< lobby> Tanorik ended game: "Megamuffins’s game" (8634) at turn: 20 with reason: 'aborted'. (socket: 13176) 20120326 07:15:05< tuxlobby> 20120326 07:15:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 07:15:42< lobby> ghostgolem started game: "ghostgolem’s game" (8679) with: ghostgolem. Settings: map: multiplayer_Island_of_the_Horatii era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 07:17:23< lobby> Atasco ended game: "AxalaraFlame’s game" (8640) at turn: 17 with reason: 'game over'. (socket: 12661) 20120326 07:17:25< dicplobby> 20120326 07:17:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 07:18:56< lobby> AxalaraFlame started game: "AxalaraFlame’s game" (8680) with: AxalaraFlame, kuruption, Atasco, cp9. Settings: map: user_map era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 07:18:58< lobby> 20120326 07:18:58 Statistics: number_of_games = 28 number_of_users = 92 lobby_users = 24 20120326 07:20:05< tuxlobby> 20120326 07:20:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 07:22:24< dicplobby> 20120326 07:22:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 07:23:47< lobby> Godwalking ended game: "Godwalking’s game" (8663) at turn: 12 with reason: 'game over'. (socket: 13233) 20120326 07:23:58< lobby> 20120326 07:23:58 Statistics: number_of_games = 28 number_of_users = 88 lobby_users = 21 20120326 07:24:08< lobby> deviouschild advanced game: "deviouschild’s game" (8678) with: deviouschild. Settings: map: TT_02_the_castle era: XP: GPV: fog: shroud: observers: shuffle: timer: 20120326 07:24:20< lobby> xbriannova started game: "4 minutes timer game" (8681) with: xbriannova, irenicus09, solarheinous, Zinnsoldat. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 07:25:05< tuxlobby> 20120326 07:25:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 07:26:34< lobby> ghostgolem ended game: "ghostgolem’s game" (8679) at turn: 8 with reason: 'aborted'. (socket: 13260) 20120326 07:27:24< dicplobby> 20120326 07:27:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 07:28:30< lobby> kirin ended game: "Cessna’s game RANDOM" (8654) at turn: 9 with reason: 'game over'. (socket: 13226) 20120326 07:28:58< lobby> 20120326 07:28:58 Statistics: number_of_games = 27 number_of_users = 89 lobby_users = 22 20120326 07:29:47< lobby> Cessna started game: "Cessna’s game RANDOM" (8682) with: Cessna, LeftFist, Hakun, pfgtre. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 07:30:05< tuxlobby> 20120326 07:30:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 07:30:07< lobby> ghostgolem started game: "ghostgolem’s game" (8683) with: ghostgolem. Settings: map: multiplayer_3p_Morituri era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 07:32:24< dicplobby> 20120326 07:32:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 07:32:54< lobby> ViralFerret ended game: "Kitoshide’s game" (8633) at turn: 26 with reason: 'game over'. (socket: 12875) 20120326 07:33:59< lobby> 20120326 07:33:59 Statistics: number_of_games = 27 number_of_users = 88 lobby_users = 21 20120326 07:34:17< lobby> Griffon ended game: "Flarix’s game" (8629) at turn: 17 with reason: 'game over'. (socket: 13179) 20120326 07:34:53< lobby> xbriannova ended game: "4 minutes timer game" (8681) at turn: 4 with reason: 'aborted'. (socket: 13265) 20120326 07:35:05< tuxlobby> 20120326 07:35:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 07:36:08< lobby> abhijit ended game: "ArmOrAttAk’s game" (8651) at turn: 10 with reason: 'game over'. (socket: 13208) 20120326 07:36:30< lobby> any games? 20120326 07:36:31< lobby> xbriannova started game: "4 minutes game remake" (8684) with: xbriannova, solarheinous, RickDangerous, ArmOrAttAk. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 07:37:01< lobby> cow ended game: "cow的游戏" (8669) at turn: 10 with reason: 'aborted'. (socket: 13169) 20120326 07:37:24< dicplobby> 20120326 07:37:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 07:37:27< lobby> RickDangerous ended game: "4 minutes game remake" (8684) at turn: 1 with reason: 'aborted'. (socket: 13279) 20120326 07:38:14< lobby> xbriannova started game: "4 minutes game remake remake" (8685) with: xbriannova, RickDangerous, ArmOrAttAk, brandonly. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 07:38:53< lobby> Nitetrip ended game: "Sanctity’s game" (8670) at turn: 10 with reason: 'game over'. (socket: 13239) 20120326 07:38:55< lobby> priya91 ended game: "priya91’s game" (8659) at turn: 15 with reason: 'game over'. (socket: 11723) 20120326 07:38:59< lobby> 20120326 07:38:59 Statistics: number_of_games = 22 number_of_users = 86 lobby_users = 28 20120326 07:40:05< tuxlobby> 20120326 07:40:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 07:40:11< lobby> cow started game: "cow的游戏" (8687) with: cow, abhijit. Settings: map: multiplayer_Basilisk era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 07:40:55< lobby> deviouschild ended game: "deviouschild’s game" (8678) at turn: 13 with reason: 'game over'. (socket: 13256) 20120326 07:41:39< lobby> Wagolita ended game: "Bollywood Live, starring Joe, Helen, and Wendy!" (8658) at turn: 21 with reason: 'aborted'. (socket: 12756) 20120326 07:42:21< lobby> ArmOrAttAk started game: "ArmOrAttAk’s game" (8690) with: ArmOrAttAk, xbriannova, RickDangerous, Fetter. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 07:42:23< lobby> psweet started game: "psweet’s game" (8689) with: psweet, priya91. Settings: map: multiplayer_Forest_of_Fear era: era_default XP: 50 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 07:42:25< dicplobby> 20120326 07:42:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 07:42:32< lobby> Sanctity started game: "Sanctity’s game" (8686) with: Sanctity, Nitetrip. Settings: map: multiplayer_Xanthe_Chaos era: era_default XP: 200 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 07:42:54< lobby> Beanbarian started game: "Bollywood Live! Helen vs. Wendy!" (8691) with: Beanbarian, Wagolita. Settings: map: user_map era: era_default XP: GPV: fog: shroud: observers: no shuffle: no timer: 20120326 07:43:07< lobby> Nitetrip ended game: "Sanctity’s game" (8686) at turn: 1 with reason: 'aborted'. (socket: 13239) 20120326 07:43:23< lobby> brandonly ended game: "4 minutes game remake remake" (8685) at turn: 1 with reason: 'aborted'. (socket: 13280) 20120326 07:43:46< lobby> ghostgolem ended game: "ghostgolem’s game" (8683) at turn: 12 with reason: 'game over'. (socket: 13260) 20120326 07:43:59< lobby> 20120326 07:43:59 Statistics: number_of_games = 24 number_of_users = 89 lobby_users = 26 20120326 07:44:03< lobby> OlSalty ended game: "OlSalty’s game" (8637) at turn: 18 with reason: 'game over'. (socket: 13103) 20120326 07:44:16< lobby> Sanctity started game: "Sanctity’s game" (8692) with: Sanctity, Nitetrip. Settings: map: multiplayer_4p_Underworld era: era_default XP: 200 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 07:44:30< lobby> Sanctity ended game: "Sanctity’s game" (8692) at turn: 1 with reason: 'aborted'. (socket: 13206) 20120326 07:45:05< tuxlobby> 20120326 07:45:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 07:45:17< lobby> Sanctity started game: "Sanctity’s game" (8695) with: Sanctity, Nitetrip. Settings: map: multiplayer_4p_Underworld era: era_default XP: 200 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 07:45:17< lobby> Swiifty started game: "Swiifty’s game" (8696) with: Swiifty. Settings: map: vs_Survival_2p era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 07:46:24< lobby> deviouschild started game: "deviouschild’s game" (8694) with: deviouschild. Settings: map: TT_01_attack_to_elf_city era: era_heroes XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 07:47:24< dicplobby> 20120326 07:47:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 07:48:34< lobby> ghostgolem started game: "ghostgolem’s game" (8697) with: ghostgolem, solarheinous, siofsjbvmbtiqehasif. Settings: map: multiplayer_Island_of_the_Horatii era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 07:48:59< lobby> 20120326 07:48:59 Statistics: number_of_games = 26 number_of_users = 89 lobby_users = 24 20120326 07:49:25< lobby> Duris ended game: "boco’s game" (8667) at turn: 15 with reason: 'aborted'. (socket: 12982) 20120326 07:49:41< lobby> boco started game: "boco’s game" (8699) with: boco, Duris. Settings: map: elf_war_3_Inside_the_Mountain_normal era: era_default XP: GPV: fog: shroud: observers: no shuffle: no timer: 20120326 07:50:01< lobby> boco ended game: "boco’s game" (8699) at turn: 14 with reason: 'aborted'. (socket: 12980) 20120326 07:50:05< tuxlobby> 20120326 07:50:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 07:50:34< lobby> Duris started game: "Duris’s game" (8700) with: Duris, boco. Settings: map: elf_war_3_Inside_the_Mountain_normal era: era_default XP: GPV: fog: shroud: observers: no shuffle: no timer: 20120326 07:52:02< lobby> WarDuck ended game: "Durr’s game" (8676) at turn: 16 with reason: 'aborted'. (socket: 13160) 20120326 07:52:24< dicplobby> 20120326 07:52:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 07:53:18< lobby> platypus ended game: "platypus’s game" (8657) at turn: 17 with reason: 'game over'. (socket: 13193) 20120326 07:53:49< lobby> RicardoViramontes started game: "RicardoViramontes’s game" (8701) with: RicardoViramontes. Settings: map: Creep War New v0.2.6 era: era_default XP: 60 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 07:53:59< lobby> 20120326 07:53:59 Statistics: number_of_games = 24 number_of_users = 86 lobby_users = 24 20120326 07:55:05< tuxlobby> 20120326 07:55:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 07:55:11< lobby> Direwolf1 ended game: "Direwolf1’s game" (8673) at turn: 23 with reason: 'aborted'. (socket: 13225) 20120326 07:57:24< dicplobby> 20120326 07:57:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 07:57:25< lobby> RicardoViramontes ended game: "RicardoViramontes’s game" (8701) at turn: 1 with reason: 'aborted'. (socket: 13292) 20120326 07:57:35< lobby> deviouschild advanced game: "deviouschild’s game" (8694) with: deviouschild. Settings: map: TT_02_the_castle era: XP: GPV: fog: shroud: observers: shuffle: timer: 20120326 07:58:00< lobby> Swiifty ended game: "Swiifty’s game" (8696) at turn: 12 with reason: 'game over'. (socket: 13287) 20120326 07:58:31< lobby> Swiifty started game: "Swiifty’s game" (8703) with: Swiifty. Settings: map: vs_Survival_2p era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 07:58:59< lobby> 20120326 07:58:59 Statistics: number_of_games = 23 number_of_users = 82 lobby_users = 25 20120326 07:59:30< lobby> MsEdyn ended game: "bluewolf27’s game" (8645) at turn: 32 with reason: 'game over'. (socket: 13189) 20120326 08:00:01< lobby> Atasco ended game: "AxalaraFlame’s game" (8680) at turn: 11 with reason: 'game over'. (socket: 12661) 20120326 08:00:05< tuxlobby> 20120326 08:00:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 08:00:08< lobby> gg 20120326 08:00:12< lobby> ill go to sleep now 20120326 08:00:16< lobby> its 8 AM and im very tired 20120326 08:00:18< lobby> yes u should 20120326 08:00:30< lobby> and if l were not wrong 20120326 08:00:38< lobby> u stared it before 5am 20120326 08:00:58< lobby> in german 20120326 08:01:51< lobby> Swiifty ended game: "Swiifty’s game" (8703) at turn: 5 with reason: 'aborted'. (socket: 13287) 20120326 08:02:24< dicplobby> 20120326 08:02:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 08:02:39< lobby> op started game: "op的游戏" (8706) with: op, mumma, Keither, majo. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 08:02:42< lobby> Swiifty started game: "Swiifty’s game" (8707) with: Swiifty. Settings: map: vs_Survival_2p era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 08:03:10< lobby> Cessna ended game: "Cessna’s game RANDOM" (8682) at turn: 10 with reason: 'game over'. (socket: 13222) 20120326 08:03:48< lobby> SLAVA1 ended game: "mjr’s game" (8677) at turn: 10 with reason: 'aborted'. (socket: 13278) 20120326 08:04:01< lobby> 20120326 08:04:01 Statistics: number_of_games = 22 number_of_users = 82 lobby_users = 29 20120326 08:04:59< lobby> Nitetrip ended game: "Sanctity’s game" (8695) at turn: 7 with reason: 'aborted'. (socket: 13239) 20120326 08:05:05< tuxlobby> 20120326 08:05:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 08:05:09< lobby> Demiz started game: "Demiz’s game" (8708) with: Demiz, KLASHINKOOV, pfgtre, Jaglavak, SLAVA1, mjr. Settings: map: Creep version v0.2.11.1 era: Creep_Era_v0.2.11.1 XP: 60 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 08:06:21< lobby> bluewolf27 started game: "bluewolf27’s game" (8705) with: bluewolf27, Trigramatic, MsEdyn, Darksol88. Settings: map: multiplayer_8p_Mokena_Prairie era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 08:07:24< dicplobby> 20120326 08:07:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 08:09:01< lobby> 20120326 08:09:01 Statistics: number_of_games = 22 number_of_users = 82 lobby_users = 22 20120326 08:09:07< lobby> Tanorik started game: "Tanorik’s game" (8711) with: Tanorik. Settings: map: multiplayer_The_Freelands era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 08:09:25< lobby> Noir started game: "Noir’s game" (8710) with: Noir, Slavik. Settings: map: prison_break era: era_default XP: 60 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 08:10:00< lobby> deviouschild ended game: "deviouschild’s game" (8694) at turn: 8 with reason: 'game over'. (socket: 13256) 20120326 08:10:05< tuxlobby> 20120326 08:10:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 08:11:27< lobby> boco ended game: "Duris’s game" (8700) at turn: 20 with reason: 'aborted'. (socket: 12980) 20120326 08:11:44< lobby> Duris started game: "Duris’s game" (8712) with: Duris, boco. Settings: map: elf_war_3_Inside_the_Mountain_normal era: era_default XP: GPV: fog: shroud: observers: no shuffle: no timer: 20120326 08:12:24< dicplobby> 20120326 08:12:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 08:12:41< lobby> Swiifty ended game: "Swiifty’s game" (8707) at turn: 13 with reason: 'game over'. (socket: 13287) 20120326 08:13:06< lobby> Swiifty started game: "Swiifty’s game" (8715) with: Swiifty. Settings: map: vs_Survival_2p era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 08:13:25< lobby> boco ended game: "Duris’s game" (8712) at turn: 20 with reason: 'aborted'. (socket: 12980) 20120326 08:13:36< lobby> Duris started game: "Duris’s game" (8716) with: Duris, boco. Settings: map: elf_war_3_Inside_the_Mountain_normal era: era_default XP: GPV: fog: shroud: observers: no shuffle: no timer: 20120326 08:13:51< lobby> deviouschild started game: "deviouschild’s game" (8713) with: deviouschild. Settings: map: TT_01_attack_to_elf_city era: era_heroes XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 08:14:01< lobby> 20120326 08:14:01 Statistics: number_of_games = 23 number_of_users = 81 lobby_users = 20 20120326 08:14:43< lobby> voltcs started game: "voltcs’s game" (8714) with: voltcs, Lulu. Settings: map: multiplayer_Hornshark_Island era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 08:15:06< tuxlobby> 20120326 08:15:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 08:16:15< lobby> Lulu ended game: "voltcs’s game" (8714) at turn: 1 with reason: 'aborted'. (socket: 13309) 20120326 08:16:35< lobby> Swiifty ended game: "Swiifty’s game" (8715) at turn: 7 with reason: 'game over'. (socket: 13287) 20120326 08:16:45< lobby> Wagolita ended game: "Bollywood Live! Helen vs. Wendy!" (8691) at turn: 28 with reason: 'aborted'. (socket: 12756) 20120326 08:17:17< lobby> Swiifty started game: "Swiifty’s game" (8717) with: Swiifty. Settings: map: vs_Survival_2p era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 08:17:24< dicplobby> 20120326 08:17:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 08:17:50< lobby> voltcs started game: "voltcs’s game" (8718) with: voltcs, Lulu. Settings: map: multiplayer_Sullas_Ruins era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 08:19:01< lobby> 20120326 08:19:01 Statistics: number_of_games = 22 number_of_users = 77 lobby_users = 20 20120326 08:19:50< lobby> Grezdaed advanced game: "Grezdaed’s game" (8644) with: Grezdaed, Orathoy, Nohgoa. Settings: map: TGQ_Scenario2_Sand era: XP: 100 GPV: fog: shroud: observers: shuffle: timer: 20120326 08:20:06< tuxlobby> 20120326 08:20:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 08:21:28< lobby> Grezdaed ended game: "Grezdaed’s game" (8644) at turn: 1 with reason: 'game over'. (socket: 13194) 20120326 08:21:38< lobby> Slavik ended game: "Noir’s game" (8710) at turn: 8 with reason: 'game over'. (socket: 13308) 20120326 08:22:24< dicplobby> 20120326 08:22:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 08:22:50< lobby> deviouschild ended game: "deviouschild’s game" (8713) at turn: 5 with reason: 'game over'. (socket: 13256) 20120326 08:23:21< lobby> SLAVA1 started game: "Игра SLAVA1" (8720) with: SLAVA1, Zinnsoldat. Settings: map: multiplayer_Basilisk era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 08:24:01< lobby> 20120326 08:24:01 Statistics: number_of_games = 20 number_of_users = 76 lobby_users = 24 20120326 08:25:05< tuxlobby> 20120326 08:25:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 08:26:12< lobby> CenetaurmanE52 ended game: "Oranges, Impecable Oranges (Reserved)" (8631) at turn: 27 with reason: 'aborted'. (socket: 13144) 20120326 08:27:24< dicplobby> 20120326 08:27:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 08:28:43< lobby> Noir started game: "Noir’s game" (8725) with: Noir. Settings: map: 3pSurvival era: era_arma_standard XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 08:29:01< lobby> 20120326 08:29:01 Statistics: number_of_games = 21 number_of_users = 73 lobby_users = 22 20120326 08:29:52< lobby> Bobbay started game: "Игра Bobbay" (8726) with: Bobbay, Atmohspheer. Settings: map: multiplayer_Den_of_Onis era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 08:30:05< tuxlobby> 20120326 08:30:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 08:30:05< lobby> Swiifty ended game: "Swiifty’s game" (8717) at turn: 13 with reason: 'game over'. (socket: 13287) 20120326 08:30:33< lobby> Swiifty started game: "Swiifty’s game" (8727) with: Swiifty. Settings: map: vs_Survival_2p era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 08:31:31< lobby> Noir ended game: "Noir’s game" (8725) at turn: 4 with reason: 'game over'. (socket: 13321) 20120326 08:31:51< lobby> Noir started game: "Noir’s game" (8728) with: Noir. Settings: map: 3pSurvival era: era_arma_extended XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 08:31:58< lobby> Fetter ended game: "ArmOrAttAk’s game" (8690) at turn: 12 with reason: 'aborted'. (socket: 13285) 20120326 08:32:24< dicplobby> 20120326 08:32:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 08:34:01< lobby> 20120326 08:34:01 Statistics: number_of_games = 21 number_of_users = 75 lobby_users = 25 20120326 08:34:31< lobby> Noir ended game: "Noir’s game" (8728) at turn: 4 with reason: 'aborted'. (socket: 13321) 20120326 08:35:05< tuxlobby> 20120326 08:35:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 08:37:24< dicplobby> 20120326 08:37:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 08:38:51< lobby> majo ended game: "op的游戏" (8706) at turn: 9 with reason: 'aborted'. (socket: 13291) 20120326 08:39:01< lobby> 20120326 08:39:01 Statistics: number_of_games = 20 number_of_users = 73 lobby_users = 28 20120326 08:39:08< lobby> ukian ended game: "DroppedConnection’s game" (8610) at turn: 40 with reason: 'game over'. (socket: 13155) 20120326 08:40:05< tuxlobby> 20120326 08:40:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 08:40:37< lobby> Beljuril started game: "Jeu de Beljuril" (8730) with: Beljuril, Tuerk, Profprofprof. Settings: map: Dov_MP_Orocia era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 08:42:24< dicplobby> 20120326 08:42:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 08:43:21< lobby> op started game: "op的游戏" (8731) with: op, Realeyz, Knight111, majo. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 08:43:40< lobby> Duris ended game: "Duris’s game" (8716) at turn: 30 with reason: 'aborted'. (socket: 12982) 20120326 08:44:01< lobby> 20120326 08:44:01 Statistics: number_of_games = 19 number_of_users = 72 lobby_users = 25 20120326 08:45:05< tuxlobby> 20120326 08:45:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 08:45:14< lobby> Fetter started game: "(L) Ladder game (Fetter, 1664)" (8729) with: Fetter, Bonobo. Settings: map: RMP_Classic era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 08:45:19< lobby> Fetter advanced game: "(L) Ladder game (Fetter, 1664)" (8729) with: Fetter, Bonobo. Settings: map: RMP_Silverhead_Crossing_12 era: XP: 70 GPV: fog: shroud: observers: shuffle: timer: 20120326 08:46:14< lobby> siofsjbvmbtiqehasif ended game: "ghostgolem’s game" (8697) at turn: 17 with reason: 'game over'. (socket: 13288) 20120326 08:47:07< lobby> anyone want to host a colosseum match? 20120326 08:47:24< dicplobby> 20120326 08:47:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 08:47:25< lobby> me 20120326 08:47:31< lobby> i host 20120326 08:47:37< lobby> ok 20120326 08:48:19< lobby> Swiifty ended game: "Swiifty’s game" (8727) at turn: 17 with reason: 'game over'. (socket: 13287) 20120326 08:49:01< lobby> 20120326 08:49:01 Statistics: number_of_games = 21 number_of_users = 71 lobby_users = 23 20120326 08:49:36< lobby> Swiifty started game: "Swiifty’s game" (8735) with: Swiifty. Settings: map: vs_Survival_2p era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 08:50:05< tuxlobby> 20120326 08:50:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 08:52:00< lobby> Beanbarian started game: "Bollywood Allstars" (8736) with: Beanbarian, Wagolita. Settings: map: user_map era: era_default XP: 50 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 08:52:24< dicplobby> 20120326 08:52:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 08:54:01< lobby> 20120326 08:54:01 Statistics: number_of_games = 22 number_of_users = 71 lobby_users = 19 20120326 08:55:05< tuxlobby> 20120326 08:55:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 08:56:24< lobby> paiolki started game: "paiolki’s game" (8739) with: paiolki, ludo. Settings: map: multiplayer_Hamlets era: Ageless Era XP: 50 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 08:57:24< dicplobby> 20120326 08:57:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 08:57:35< lobby> Swiifty ended game: "Swiifty’s game" (8735) at turn: 11 with reason: 'game over'. (socket: 13287) 20120326 08:58:38< lobby> Swiifty started game: "Swiifty’s game" (8741) with: Swiifty. Settings: map: vs_Survival_2p era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 08:59:01< lobby> 20120326 08:59:01 Statistics: number_of_games = 22 number_of_users = 73 lobby_users = 18 20120326 09:00:05< tuxlobby> 20120326 09:00:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 09:00:36< lobby> moonchild started game: "GL & HF" (8742) with: moonchild, mumma, Mukkman13, Gogoth. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 09:01:05< lobby> basiir started game: "basiir’s game" (8734) with: basiir, Keither. Settings: map: Colosseum_scenario era: Ageless RPG Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 09:02:24< dicplobby> 20120326 09:02:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 09:04:01< lobby> 20120326 09:04:01 Statistics: number_of_games = 24 number_of_users = 75 lobby_users = 16 20120326 09:05:05< tuxlobby> 20120326 09:05:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 09:05:29< lobby> abhijit ended game: "cow的游戏" (8687) at turn: 18 with reason: 'aborted'. (socket: 13208) 20120326 09:05:37< lobby> C0mmand01 started game: "C0mmand01’s game" (8744) with: C0mmand01, taschris01. Settings: map: multiplayer_Random_Map era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 09:07:24< dicplobby> 20120326 09:07:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 09:08:49< lobby> Tanorik ended game: "Tanorik’s game" (8711) at turn: 111 with reason: 'aborted'. (socket: 13176) 20120326 09:09:01< lobby> 20120326 09:09:01 Statistics: number_of_games = 21 number_of_users = 75 lobby_users = 20 20120326 09:10:05< tuxlobby> 20120326 09:10:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 09:11:44< lobby> Lulu ended game: "voltcs’s game" (8718) at turn: 16 with reason: 'game over'. (socket: 13309) 20120326 09:12:24< dicplobby> 20120326 09:12:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 09:12:57< lobby> Atmohspheer ended game: "Игра Bobbay" (8726) at turn: 18 with reason: 'game over'. (socket: 13305) 20120326 09:14:01< lobby> 20120326 09:14:01 Statistics: number_of_games = 19 number_of_users = 72 lobby_users = 21 20120326 09:15:05< tuxlobby> 20120326 09:15:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 09:16:35< lobby> Clemens started game: "Clemenss Partie" (8747) with: Clemens. Settings: map: Colosseum_scenario era: Colosseum_Extended_era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 09:16:38< lobby> Bonobo ended game: "(L) Ladder game (Fetter, 1664)" (8729) at turn: 10 with reason: 'game over'. (socket: 13327) 20120326 09:17:07< lobby> Fetter started game: "Fetter for Bonobo" (8749) with: Fetter. Settings: map: RMP_Silverhead_Crossing_12 era: era_default XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 09:17:11< lobby> Ultron_Lives started game: "Ultron_Lives’s game" (8748) with: Ultron_Lives. Settings: map: multiplayer_Auction-X era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 09:17:14< lobby> Fetter ended game: "Fetter for Bonobo" (8749) at turn: 7 with reason: 'aborted'. (socket: 13285) 20120326 09:17:24< dicplobby> 20120326 09:17:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 09:17:50< lobby> Fetter started game: "Fetter for Bonobo" (8750) with: Fetter, Bonobo. Settings: map: RMP_Silverhead_Crossing_12 era: era_default XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 09:18:12< lobby> Clemens ended game: "Clemenss Partie" (8747) at turn: 1 with reason: 'aborted'. (socket: 13363) 20120326 09:19:01< lobby> 20120326 09:19:01 Statistics: number_of_games = 21 number_of_users = 75 lobby_users = 23 20120326 09:19:07< lobby> Ultron_Lives ended game: "Ultron_Lives’s game" (8748) at turn: 1 with reason: 'aborted'. (socket: 13018) 20120326 09:19:42< lobby> Ultron_Lives started game: "Ultron_Lives’s game" (8752) with: Ultron_Lives. Settings: map: multiplayer_Hamlets era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 09:19:55< lobby> SLAVA1 ended game: "Игра SLAVA1" (8720) at turn: 18 with reason: 'aborted'. (socket: 13278) 20120326 09:20:05< tuxlobby> 20120326 09:20:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 09:20:07< lobby> Mukkman13 started game: "Mukkman13’s game" (8751) with: Mukkman13, Broskii. Settings: map: multiplayer_Ruins_of_Terra-Dwelve era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 09:20:35< lobby> pleiteseinistok started game: "pleiteseinistoks Partie" (8754) with: pleiteseinistok. Settings: map: multiplayer_Auction-X era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 09:21:01< lobby> vipko started game: "vipko のゲーム" (8753) with: vipko. Settings: map: multiplayer_2p_Dark_Forecast era: era_default XP: 30 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 09:21:13< lobby> MsEdyn ended game: "bluewolf27’s game" (8705) at turn: 18 with reason: 'game over'. (socket: 13189) 20120326 09:21:28< lobby> Swiifty ended game: "Swiifty’s game" (8741) at turn: 32 with reason: 'game over'. (socket: 13287) 20120326 09:22:25< dicplobby> 20120326 09:22:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 09:24:01< lobby> 20120326 09:24:01 Statistics: number_of_games = 22 number_of_users = 71 lobby_users = 19 20120326 09:24:14< lobby> bluewolf27 started game: "bluewolf27’s game" (8757) with: bluewolf27, Darksol88, Trigramatic. Settings: map: multiplayer_The_Manzivan_Traps era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 09:25:05< tuxlobby> 20120326 09:25:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 09:25:33< lobby> Bonobo ended game: "Fetter for Bonobo" (8750) at turn: 7 with reason: 'game over'. (socket: 13327) 20120326 09:25:52< lobby> ladder game anyone? 20120326 09:25:52< lobby> krack started game: "krack’s game" (8758) with: krack, peter. Settings: map: multiplayer_The_Freelands era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 09:26:43< lobby> priya91 ended game: "psweet’s game" (8689) at turn: 18 with reason: 'game over'. (socket: 11723) 20120326 09:27:03< lobby> rezazsa started game: "rezazsa’s game" (8759) with: rezazsa, 27pyc. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 09:27:24< dicplobby> 20120326 09:27:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 09:28:35< lobby> SLAVA1 started game: "Игра SLAVA1" (8761) with: SLAVA1, hay206. Settings: map: multiplayer_2p_Dark_Forecast era: era_default XP: 100 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 09:28:40< lobby> xGalenx started game: "2 min for turn" (8762) with: xGalenx, RickDangerous, firste, WindEnchanter. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 09:28:48< lobby> Ultron_Lives ended game: "Ultron_Lives’s game" (8752) at turn: 14 with reason: 'aborted'. (socket: 13018) 20120326 09:29:01< lobby> 20120326 09:29:01 Statistics: number_of_games = 23 number_of_users = 73 lobby_users = 20 20120326 09:29:30< lobby> Demiz ended game: "Demiz’s game" (8708) at turn: 30 with reason: 'game over'. (socket: 13297) 20120326 09:29:33< lobby> Ultron_Lives started game: "Ultron_Lives’s game" (8763) with: Ultron_Lives. Settings: map: multiplayer_Hamlets era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 09:30:05< tuxlobby> 20120326 09:30:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 09:32:24< dicplobby> 20120326 09:32:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 09:32:50< lobby> Gogoth ended game: "GL & HF" (8742) at turn: 8 with reason: 'game over'. (socket: 13348) 20120326 09:33:07< lobby> Narcissus-Pontius ended game: "Ultron_Lives’s game" (8675) at turn: 31 with reason: 'aborted'. (socket: 13217) 20120326 09:33:32< lobby> babaOriley started game: "Deep, Ageless Orocia!" (8766) with: babaOriley, goldfrog. Settings: map: Dov_MP_Deep_Shrine era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 09:34:01< lobby> 20120326 09:34:01 Statistics: number_of_games = 24 number_of_users = 73 lobby_users = 21 20120326 09:35:06< tuxlobby> 20120326 09:35:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 09:35:10< lobby> Ultron_Lives ended game: "Ultron_Lives’s game" (8763) at turn: 7 with reason: 'game over'. (socket: 13018) 20120326 09:35:31< lobby> BasiC ended game: "BasiC’s game" (8528) at turn: 22 with reason: 'game over'. (socket: 13033) 20120326 09:35:32< lobby> moonchild started game: "Isar no noobs plz" (8767) with: moonchild, Bobbay, irenicus09, cp9. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 09:36:07< lobby> Ultron_Lives started game: "Ultron_Lives’s game" (8768) with: Ultron_Lives. Settings: map: multiplayer_Hamlets era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 09:37:24< dicplobby> 20120326 09:37:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 09:38:37< lobby> paiolkino started game: "paiolkino’s game" (8770) with: paiolkino, ludo. Settings: map: multiplayer_Hamlets era: Ageless Era XP: 50 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 09:39:01< lobby> 20120326 09:39:01 Statistics: number_of_games = 24 number_of_users = 74 lobby_users = 20 20120326 09:39:08< lobby> krack ended game: "krack’s game" (8758) at turn: 6 with reason: 'aborted'. (socket: 13383) 20120326 09:39:12< lobby> Pokemaniac_Matt ended game: "basiir’s game" (8734) at turn: 18 with reason: 'aborted'. (socket: 13353) 20120326 09:39:31< lobby> Ultron_Lives ended game: "Ultron_Lives’s game" (8768) at turn: 5 with reason: 'game over'. (socket: 13018) 20120326 09:40:06< tuxlobby> 20120326 09:40:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 09:40:10< lobby> Ultron_Lives started game: "Ultron_Lives’s game" (8772) with: Ultron_Lives. Settings: map: multiplayer_Hamlets era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 09:42:24< dicplobby> 20120326 09:42:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 09:42:30< lobby> R-I-P started game: "R-I-Ps Partie" (8775) with: R-I-P, mumma. Settings: map: multiplayer_Cynsaun_Battlefield era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 09:44:01< lobby> 20120326 09:44:01 Statistics: number_of_games = 24 number_of_users = 72 lobby_users = 22 20120326 09:45:02< lobby> basiir started game: "basiir’s game - remaking of the last game - other can join" (8771) with: basiir, Keither, Pokemaniac_Matt. Settings: map: Colosseum_scenario era: Ageless RPG Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 09:45:06< tuxlobby> 20120326 09:45:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 09:46:44< lobby> Broskii ended game: "Mukkman13’s game" (8751) at turn: 8 with reason: 'aborted'. (socket: 13362) 20120326 09:47:04< lobby> majo ended game: "op的游戏" (8731) at turn: 15 with reason: 'game over'. (socket: 13291) 20120326 09:47:15< lobby> Mister_Cuddles ended game: "Riger’s game" (8671) at turn: 21 with reason: 'aborted'. (socket: 13249) 20120326 09:47:25< dicplobby> 20120326 09:47:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 09:47:48< lobby> Ultron_Lives ended game: "Ultron_Lives’s game" (8772) at turn: 9 with reason: 'aborted'. (socket: 13018) 20120326 09:48:01< lobby> SuicideGirl started game: "I am seriously non-F'N-beatable. Get humiliated" (8777) with: SuicideGirl, Gaysian, majo, Funky_penguin. Settings: map: multiplayer_Clash era: era_default XP: 90 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 09:48:46< lobby> Ultron_Lives started game: "Ultron_Lives’s game" (8779) with: Ultron_Lives, CRAZYpotato. Settings: map: multiplayer_Hamlets era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 09:49:01< lobby> 20120326 09:49:01 Statistics: number_of_games = 20 number_of_users = 65 lobby_users = 21 20120326 09:50:05< tuxlobby> 20120326 09:50:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 09:51:23< lobby> pleiteseinistok ended game: "pleiteseinistoks Partie" (8754) at turn: 35 with reason: 'game over'. (socket: 13374) 20120326 09:51:41< lobby> paiolki ended game: "paiolki’s game" (8739) at turn: 11 with reason: 'aborted' and disconnected. (socket: 13342) 20120326 09:52:24< dicplobby> 20120326 09:52:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 09:53:50< lobby> cp9 ended game: "Isar no noobs plz" (8767) at turn: 8 with reason: 'aborted'. (socket: 13394) 20120326 09:54:01< lobby> 20120326 09:54:01 Statistics: number_of_games = 18 number_of_users = 65 lobby_users = 23 20120326 09:54:02< lobby> moonchild started game: "Isar no noobs plz" (8780) with: moonchild, Bobbay, Loca, cp9. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 09:55:05< tuxlobby> 20120326 09:55:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 09:55:41< lobby> pleiteseinistok started game: "pleiteseinistoks Partie" (8781) with: pleiteseinistok. Settings: map: multiplayer_Auction-X era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 09:57:11< lobby> anyone up for a creep war? 20120326 09:57:24< dicplobby> 20120326 09:57:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 09:59:01< lobby> 20120326 09:59:01 Statistics: number_of_games = 20 number_of_users = 67 lobby_users = 21 20120326 10:00:05< tuxlobby> 20120326 10:00:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 10:00:33< lobby> cupcake started game: "cupcake’s game RANDOM HEROES" (8782) with: cupcake, tadpol. Settings: map: Creep War New Map v0.2.11.1 era: Creep_Era_v0.2.11.1 XP: 60 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 10:02:24< dicplobby> 20120326 10:02:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 10:04:01< lobby> 20120326 10:04:01 Statistics: number_of_games = 21 number_of_users = 71 lobby_users = 23 20120326 10:05:05< tuxlobby> 20120326 10:05:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 10:05:58< lobby> Ultron_Lives ended game: "Ultron_Lives’s game" (8779) at turn: 9 with reason: 'aborted'. (socket: 13018) 20120326 10:07:20< lobby> pleiteseinistok ended game: "pleiteseinistoks Partie" (8781) at turn: 20 with reason: 'game over'. (socket: 13374) 20120326 10:07:24< dicplobby> 20120326 10:07:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 10:09:01< lobby> 20120326 10:09:01 Statistics: number_of_games = 20 number_of_users = 70 lobby_users = 24 20120326 10:09:39< lobby> deviouschild started game: "deviouschild’s game" (8790) with: deviouschild. Settings: map: Diggit era: era_heroes XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 10:10:05< tuxlobby> 20120326 10:10:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 10:10:40< lobby> babaOriley ended game: "Deep, Ageless Orocia!" (8766) at turn: 13 with reason: 'aborted'. (socket: 13388) 20120326 10:11:03< lobby> babaOriley started game: "babaOriley’s game" (8791) with: babaOriley, goldfrog. Settings: map: Dov_MP_Deep_Shrine era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 10:12:25< dicplobby> 20120326 10:12:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 10:14:01< lobby> 20120326 10:14:01 Statistics: number_of_games = 21 number_of_users = 72 lobby_users = 22 20120326 10:14:39< lobby> Calandryl started game: "Calandryl’s game" (8789) with: Calandryl, ukian, Panfil-Ugly, abhijit. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 10:15:05< tuxlobby> 20120326 10:15:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 10:17:24< dicplobby> 20120326 10:17:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 10:19:04< lobby> 20120326 10:19:04 Statistics: number_of_games = 21 number_of_users = 75 lobby_users = 24 20120326 10:19:34< lobby> C0mmand01 ended game: "C0mmand01’s game" (8744) at turn: 26 with reason: 'game over'. (socket: 13354) 20120326 10:20:05< tuxlobby> 20120326 10:20:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 10:21:35< lobby> walla started game: "La partida de walla" (8794) with: walla, Logitech. Settings: map: Dov_MP_Orocia era: Ageless Era XP: 60 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 10:21:48< lobby> deviouschild ended game: "deviouschild’s game" (8790) at turn: 21 with reason: 'game over'. (socket: 13423) 20120326 10:22:24< dicplobby> 20120326 10:22:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 10:24:04< lobby> 20120326 10:24:04 Statistics: number_of_games = 20 number_of_users = 73 lobby_users = 25 20120326 10:24:34< lobby> Logitech ended game: "La partida de walla" (8794) at turn: 2 with reason: 'aborted' and disconnected. (socket: 13432) 20120326 10:25:02< lobby> paiolkino ended game: "paiolkino’s game" (8770) at turn: 15 with reason: 'aborted'. (socket: 13396) 20120326 10:25:04< lobby> deviouschild started game: "deviouschild’s game" (8798) with: deviouschild. Settings: map: 00_settings era: era_heroes XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 10:25:05< tuxlobby> 20120326 10:25:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 10:25:16< lobby> sorry 20120326 10:25:17< lobby> crash.. 20120326 10:26:16< lobby> deviouschild advanced game: "deviouschild’s game" (8798) with: deviouschild. Settings: map: 01_world era: XP: GPV: fog: shroud: observers: shuffle: timer: 20120326 10:27:24< dicplobby> 20120326 10:27:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 10:27:28< lobby> walla started game: "La partida de walla" (8800) with: walla, Logitech, rotny. Settings: map: Dov_MP_Orocia era: Dov_Drops_Mod XP: 60 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 10:28:34< lobby> deviouschild ended game: "deviouschild’s game" (8798) at turn: 7 with reason: 'game over'. (socket: 13423) 20120326 10:29:04< lobby> 20120326 10:29:04 Statistics: number_of_games = 19 number_of_users = 72 lobby_users = 26 20120326 10:30:05< tuxlobby> 20120326 10:30:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 10:30:19< lobby> Wagolita ended game: "Bollywood Allstars" (8736) at turn: 50 with reason: 'game over'. (socket: 13341) 20120326 10:30:34< lobby> DwarvishRhapsody started game: "Ladder for ufn" (8801) with: DwarvishRhapsody, ufn. Settings: map: RMP_Classic era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 10:30:36< lobby> DwarvishRhapsody advanced game: "Ladder for ufn" (8801) with: DwarvishRhapsody, ufn. Settings: map: RMP_Silverhead_Crossing_12 era: XP: 70 GPV: fog: shroud: observers: shuffle: timer: 20120326 10:31:09< lobby> vipko ended game: "vipko のゲーム" (8753) at turn: 42 with reason: 'game over'. (socket: 13372) 20120326 10:31:35< lobby> 27pyc ended game: "rezazsa’s game" (8759) at turn: 13 with reason: 'aborted'. (socket: 13380) 20120326 10:32:24< dicplobby> 20120326 10:32:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 10:32:50< dicplobby> stalkerzu has logged on. (socket: 64) 20120326 10:33:10< lobby> mortalenemy ended game: "Isar no noobs plz" (8780) at turn: 8 with reason: 'aborted'. (socket: 13436) 20120326 10:33:21< dicplobby> stalkerzu has logged off. (socket: 64) 20120326 10:34:04< lobby> 20120326 10:34:04 Statistics: number_of_games = 17 number_of_users = 67 lobby_users = 25 20120326 10:34:43< lobby> moonchild started game: "ISAR no noobs plz" (8803) with: moonchild, Bobbay, Loca, Emperor. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 10:34:50< lobby> goldfrog ended game: "babaOriley’s game" (8791) at turn: 8 with reason: 'aborted'. (socket: 13152) 20120326 10:35:05< tuxlobby> 20120326 10:35:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 10:35:30< lobby> есть кто по русски говорит? 20120326 10:36:26< lobby> mumma ended game: "R-I-Ps Partie" (8775) at turn: 12 with reason: 'game over'. (socket: 13283) 20120326 10:37:02< tuxlobby> stalkerzu has logged on. (socket: 25228) 20120326 10:37:16< tuxlobby> stalkerzu has logged off. (socket: 25228) 20120326 10:37:17< lobby> vile_quitter ended game: "basiir’s game - remaking of the last game - other can join" (8771) at turn: 27 with reason: 'aborted'. (socket: 13414) 20120326 10:37:25< dicplobby> 20120326 10:37:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 10:39:04< lobby> 20120326 10:39:04 Statistics: number_of_games = 15 number_of_users = 63 lobby_users = 24 20120326 10:40:05< tuxlobby> 20120326 10:40:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 10:42:24< dicplobby> 20120326 10:42:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 10:43:04< tuxlobby> Itsuki has logged on. (socket: 25229) 20120326 10:43:12< tuxlobby> Itsuki has logged off. (socket: 25229) 20120326 10:44:04< lobby> 20120326 10:44:04 Statistics: number_of_games = 14 number_of_users = 63 lobby_users = 25 20120326 10:45:05< tuxlobby> 20120326 10:45:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 10:46:21< lobby> Crash started game: "Battaglia di Crash" (8807) with: Crash, paiolkino. Settings: map: multiplayer_Hornshark_Island era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 10:47:24< dicplobby> 20120326 10:47:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 10:49:04< lobby> 20120326 10:49:04 Statistics: number_of_games = 16 number_of_users = 64 lobby_users = 24 20120326 10:50:05< tuxlobby> 20120326 10:50:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 10:51:18< lobby> Gaysian ended game: "I am seriously non-F'N-beatable. Get humiliated" (8777) at turn: 10 with reason: 'aborted'. (socket: 13381) 20120326 10:51:55< lobby> El_Gor started game: "Игра El_Gor" (8808) with: El_Gor, Grand. Settings: map: user_map era: Ageless Era XP: 30 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 10:52:00-!- noy [~Noy@wesnoth/developer/noy] has quit [Quit: noy] 20120326 10:52:24< dicplobby> 20120326 10:52:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 10:54:04< lobby> 20120326 10:54:04 Statistics: number_of_games = 17 number_of_users = 68 lobby_users = 30 20120326 10:54:53< lobby> El_Gor ended game: "Игра El_Gor" (8808) at turn: 1 with reason: 'aborted'. (socket: 13463) 20120326 10:55:05< tuxlobby> 20120326 10:55:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 10:55:46< lobby> SLAVA1 ended game: "Игра SLAVA1" (8761) at turn: 32 with reason: 'aborted'. (socket: 13278) 20120326 10:57:24< dicplobby> 20120326 10:57:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 10:58:15< lobby> basiir started game: "basiir’s game" (8814) with: basiir, uro, Flammulus, Elvish_Warrior. Settings: map: Creep War New Map v0.2.11.1 era: Ageless RPG Era XP: 60 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 10:59:04< lobby> 20120326 10:59:04 Statistics: number_of_games = 18 number_of_users = 70 lobby_users = 28 20120326 10:59:12< lobby> janga started game: "Battaglia di janga" (8819) with: janga. Settings: map: 3pSurvival era: Ageless Era XP: 60 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 11:00:05< tuxlobby> 20120326 11:00:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 11:00:25< lobby> SuicideGirl started game: "I am seriously non-F'N-beatable. Get humiliated" (8816) with: SuicideGirl, Megatron_McPoo, Mack2rr, Barabash. Settings: map: multiplayer_Clash era: era_default XP: 90 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 11:02:24< dicplobby> 20120326 11:02:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 11:02:48< lobby> Darksol88 ended game: "bluewolf27’s game" (8757) at turn: 25 with reason: 'game over'. (socket: 13221) 20120326 11:04:17< lobby> 20120326 11:04:17 Statistics: number_of_games = 19 number_of_users = 72 lobby_users = 27 20120326 11:04:32< lobby> bluewolf27 started game: "bluewolf27’s game" (8822) with: bluewolf27, Darksol88, Trigramatic. Settings: map: multiplayer_The_Manzivan_Traps era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 11:05:06< tuxlobby> 20120326 11:05:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 11:06:28< dicplobby> martin has logged on. (socket: 65) 20120326 11:06:36< lobby> shapeshifter started game: "shapeshifter’s game" (8821) with: shapeshifter, abhijit, HappyCamper. Settings: map: World_Conquest_Start era: era_default XP: 80 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 11:06:37< dicplobby> martin has logged off. (socket: 65) 20120326 11:07:24< dicplobby> 20120326 11:07:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 11:09:17< lobby> 20120326 11:09:17 Statistics: number_of_games = 18 number_of_users = 70 lobby_users = 28 20120326 11:09:33< lobby> R-I-P started game: "R-I-Ps Partie" (8817) with: R-I-P, AssassinT90. Settings: map: multiplayer_Cynsaun_Battlefield era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 11:10:06< tuxlobby> 20120326 11:10:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 11:12:24< dicplobby> 20120326 11:12:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 11:14:17< lobby> 20120326 11:14:17 Statistics: number_of_games = 19 number_of_users = 75 lobby_users = 32 20120326 11:15:05< tuxlobby> 20120326 11:15:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 11:15:35< lobby> Germa is someone ? 20120326 11:15:47< lobby> Jawohl :) 20120326 11:17:25< dicplobby> 20120326 11:17:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 11:17:28< lobby> WindEnchanter ended game: "2 min for turn" (8762) at turn: 27 with reason: 'game over'. (socket: 13385) 20120326 11:17:33< lobby> china started game: "china’s game" (8826) with: china, Oli, 27pyc, Wrykolakas. Settings: map: 2vs2Survival era: era_default XP: 50 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 11:18:49< lobby> EpicFailGuy started game: "EpicFailGuys Partie" (8827) with: EpicFailGuy. Settings: map: Colosseum_scenario era: Colosseum_Extended_era XP: 200 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 11:19:17< lobby> 20120326 11:19:17 Statistics: number_of_games = 21 number_of_users = 76 lobby_users = 26 20120326 11:19:48< lobby> paiolkino ended game: "Battaglia di Crash" (8807) at turn: 5 with reason: 'aborted' and disconnected. (socket: 13458) 20120326 11:20:05< tuxlobby> 20120326 11:20:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 11:22:24< dicplobby> 20120326 11:22:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 11:23:00< lobby> Crash started game: "Battaglia di Crash" (8829) with: Crash, paiolkino. Settings: map: multiplayer_Hornshark_Island era: era_default XP: GPV: fog: shroud: observers: no shuffle: no timer: 20120326 11:23:10< lobby> Emmerson started game: "Emmersons Partie" (8828) with: Emmerson, Mad23, Windy, ColdxWaveGER. Settings: map: Colosseum_scenario era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 11:23:40< lobby> EpicFailGuy ended game: "EpicFailGuys Partie" (8827) at turn: 7 with reason: 'game over'. (socket: 13511) 20120326 11:24:17< lobby> 20120326 11:24:17 Statistics: number_of_games = 21 number_of_users = 77 lobby_users = 23 20120326 11:24:26< lobby> EpicFailGuy started game: "EpicFailGuys Partie" (8830) with: EpicFailGuy. Settings: map: Colosseum_scenario era: Colosseum_Extended_era XP: 200 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 11:25:05< tuxlobby> 20120326 11:25:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 11:27:24< dicplobby> 20120326 11:27:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 11:27:53< lobby> Flammulus ended game: "basiir’s game" (8814) at turn: 20 with reason: 'game over'. (socket: 13448) 20120326 11:28:56< lobby> basiir started game: "basiir’s game" (8835) with: basiir, uro, Elvish_Warrior, Flammulus. Settings: map: Creep version v0.2.11.1 era: Ageless RPG Era XP: 60 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 11:29:17< lobby> 20120326 11:29:17 Statistics: number_of_games = 23 number_of_users = 74 lobby_users = 22 20120326 11:29:58< lobby> ColdxWaveGER ended game: "Emmersons Partie" (8828) at turn: 2 with reason: 'aborted'. (socket: 13509) 20120326 11:30:05< tuxlobby> 20120326 11:30:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 11:32:24< dicplobby> 20120326 11:32:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 11:32:43< lobby> tadpol ended game: "cupcake’s game RANDOM HEROES" (8782) at turn: 46 with reason: 'game over'. (socket: 13392) 20120326 11:34:24< lobby> 20120326 11:34:24 Statistics: number_of_games = 22 number_of_users = 77 lobby_users = 25 20120326 11:34:49< lobby> Calandryl ended game: "Calandryl’s game" (8789) at turn: 25 with reason: 'aborted'. (socket: 13420) 20120326 11:35:05< tuxlobby> 20120326 11:35:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 11:35:47< lobby> ColdxWaveGER started game: "ColdxWaveGERs Partie" (8836) with: ColdxWaveGER, Windy, Emmerson. Settings: map: Colosseum_scenario era: Colosseum_Extended_era XP: 40 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 11:37:24< dicplobby> 20120326 11:37:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 11:38:25< lobby> MuDuck started game: "MuDuck" (8839) with: MuDuck, Anus, py6aka, vvij. Settings: map: user_map era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 11:38:41< lobby> Applethree started game: "Applethree’s game" (8841) with: Applethree, Noir. Settings: map: multiplayer_2p_Dark_Forecast era: era_default XP: 100 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 11:39:24< lobby> 20120326 11:39:24 Statistics: number_of_games = 22 number_of_users = 82 lobby_users = 23 20120326 11:40:05< tuxlobby> 20120326 11:40:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 11:40:58< lobby> Aksis started game: "Игра Aksis" (8840) with: Aksis, Zoldn. Settings: map: multiplayer_Castle_Hopping_Isle era: Ageless Era XP: 30 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 11:41:34< lobby> RedGlorfindel started game: "RedGlorfindels Partie" (8842) with: RedGlorfindel, pelaaja, Gogoth, Slavik. Settings: map: Survival_Fusion_2 era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 11:42:25< dicplobby> 20120326 11:42:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 11:44:24< lobby> 20120326 11:44:24 Statistics: number_of_games = 24 number_of_users = 84 lobby_users = 17 20120326 11:44:53< lobby> pleiteseinistok started game: "pleiteseinistoks Partie" (8844) with: pleiteseinistok. Settings: map: multiplayer_Auction-X era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 11:45:05< tuxlobby> 20120326 11:45:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 11:45:31< lobby> janga ended game: "Battaglia di janga" (8819) at turn: 29 with reason: 'game over'. (socket: 13465) 20120326 11:45:46< lobby> JC-D started game: "RANDOM ONLY - XP30% - Free for all !" (8843) with: JC-D, CRAZYpotato, rrrr, janga. Settings: map: user_map era: era_default XP: 30 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 11:47:24< dicplobby> 20120326 11:47:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 11:48:57< lobby> ufn ended game: "Ladder for ufn" (8801) at turn: 12 with reason: 'game over'. (socket: 13444) 20120326 11:49:24< lobby> 20120326 11:49:24 Statistics: number_of_games = 23 number_of_users = 86 lobby_users = 23 20120326 11:50:05< tuxlobby> 20120326 11:50:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 11:51:39< lobby> Crash ended game: "Battaglia di Crash" (8829) at turn: 14 with reason: 'game over'. (socket: 13500) 20120326 11:52:15< lobby> Demiz started game: "All random" (8845) with: Demiz, Tobain, nic, pelaaja. Settings: map: Creep version v0.2.11.1 era: Creep_Era_v0.2.11.1 XP: 60 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 11:52:24< dicplobby> 20120326 11:52:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 11:53:46< lobby> DwarvishRhapsody started game: "reloaded game for ufn" (8848) with: DwarvishRhapsody, ufn. Settings: map: RMP_Silverhead_Crossing_12 era: era_default XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 11:54:00< lobby> Noir ended game: "Applethree’s game" (8841) at turn: 14 with reason: 'aborted'. (socket: 13535) 20120326 11:54:24< lobby> 20120326 11:54:24 Statistics: number_of_games = 26 number_of_users = 90 lobby_users = 23 20120326 11:54:46< lobby> Applethree started game: "Applethree’s game" (8851) with: Applethree, noob-killer. Settings: map: multiplayer_2p_Dark_Forecast era: era_default XP: 100 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 11:55:05< tuxlobby> 20120326 11:55:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 11:57:24< dicplobby> 20120326 11:57:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 11:57:33< lobby> Renegat started game: "Игра Renegat" (8850) with: Renegat, AVATAR, day. Settings: map: vs_Survival_3p era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 11:59:24< lobby> 20120326 11:59:24 Statistics: number_of_games = 26 number_of_users = 91 lobby_users = 23 20120326 11:59:25< lobby> pleiteseinistok ended game: "pleiteseinistoks Partie" (8844) at turn: 27 with reason: 'aborted'. (socket: 13539) 20120326 12:00:02< lobby> El_Gor started game: "Игра El_Gor" (8860) with: El_Gor, Grand, Dankovski. Settings: map: vs_Survival_3p era: Ageless Era XP: 30 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 12:00:05< tuxlobby> 20120326 12:00:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 12:00:06< lobby> pleiteseinistok started game: "pleiteseinistoks Partie" (8861) with: pleiteseinistok. Settings: map: multiplayer_Auction-X era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 12:02:15< lobby> Wrykolakas ended game: "china’s game" (8826) at turn: 10 with reason: 'aborted'. (socket: 13389) 20120326 12:02:24< dicplobby> 20120326 12:02:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 12:03:01< lobby> shapeshifter ended game: "shapeshifter’s game" (8821) at turn: 11 with reason: 'aborted'. (socket: 13486) 20120326 12:04:24< lobby> 20120326 12:04:24 Statistics: number_of_games = 25 number_of_users = 90 lobby_users = 26 20120326 12:04:26< lobby> shapeshifter started game: "shapeshifter’s game" (8862) with: shapeshifter, abhijit, GroberKeiler. Settings: map: World_Conquest_Start era: era_default XP: 80 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 12:05:05< tuxlobby> 20120326 12:05:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 12:06:33< lobby> Tuerk ended game: "Jeu de Beljuril" (8730) at turn: 40 with reason: 'game over'. (socket: 13328) 20120326 12:07:18< lobby> FadeToBlack started game: "FadeToBlacks spel" (8863) with: FadeToBlack, joelll, Realeyz, Wind33. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 12:07:25< dicplobby> 20120326 12:07:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 12:09:16< lobby> heins started game: "heins的游戏" (8864) with: heins, MEsoulDIC. Settings: map: multiplayer_The_Freelands era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 12:09:24< lobby> 20120326 12:09:24 Statistics: number_of_games = 25 number_of_users = 93 lobby_users = 29 20120326 12:10:05< tuxlobby> 20120326 12:10:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 12:11:31< lobby> heins ended game: "heins的游戏" (8864) at turn: 1 with reason: 'aborted'. (socket: 13479) 20120326 12:12:00< lobby> KalenzZ started game: "Jeu de KalenzZ" (8866) with: KalenzZ. Settings: map: SXRPG TheEvilDead era: Ageless RPG Era XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 12:12:24< dicplobby> 20120326 12:12:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 12:12:31< lobby> day ended game: "Игра Renegat" (8850) at turn: 4 with reason: 'aborted'. (socket: 13560) 20120326 12:14:06< lobby> Emmerson ended game: "ColdxWaveGERs Partie" (8836) at turn: 8 with reason: 'aborted'. (socket: 13520) 20120326 12:14:24< lobby> 20120326 12:14:24 Statistics: number_of_games = 25 number_of_users = 95 lobby_users = 34 20120326 12:14:52< lobby> Siline started game: "啊啊啊啊啊啊啊 只是防守图啊 密码是33" (8867) with: Siline, Boxer, SilverMage. Settings: map: 3pSurvival era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 12:15:05< tuxlobby> 20120326 12:15:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 12:15:37< lobby> Renegat started game: "Игра Renegat" (8871) with: Renegat, day. Settings: map: vs_Survival_3p era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 12:15:57< lobby> Logitech ended game: "La partida de walla" (8800) at turn: 29 with reason: 'game over'. (socket: 13439) 20120326 12:16:00< lobby> Boxer ended game: "啊啊啊啊啊啊啊 只是防守图啊 密码是33" (8867) at turn: 1 with reason: 'aborted'. (socket: 13571) 20120326 12:17:19< lobby> Siline started game: "密码没改喔" (8874) with: Siline, SilverMage, Boxer. Settings: map: 3pSurvival era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 12:17:24< dicplobby> 20120326 12:17:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 12:17:35< lobby> SilverMage ended game: "密码没改喔" (8874) at turn: 1 with reason: 'aborted'. (socket: 13582) 20120326 12:18:23< lobby> pleiteseinistok ended game: "pleiteseinistoks Partie" (8861) at turn: 26 with reason: 'game over'. (socket: 13539) 20120326 12:18:26< lobby> AssassinT90 ended game: "R-I-Ps Partie" (8817) at turn: 16 with reason: 'aborted'. (socket: 13490) 20120326 12:19:29< lobby> Neuromancer started game: "Can you defeat mighty Drakes? 510 reservoir" (8875) with: Neuromancer, nut. Settings: map: multiplayer_Cynsaun_Battlefield era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 12:19:30< lobby> 20120326 12:19:30 Statistics: number_of_games = 22 number_of_users = 88 lobby_users = 30 20120326 12:19:42< lobby> widowmaker80 started game: "Ladder" (8853) with: widowmaker80, enacui. Settings: map: RMP_All era: RBY No Mirror XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 12:19:48< lobby> KalenzZ ended game: "Jeu de KalenzZ" (8866) at turn: 72 with reason: 'aborted'. (socket: 13573) 20120326 12:19:52< lobby> widowmaker80 advanced game: "Ladder" (8853) with: widowmaker80, enacui. Settings: map: RMP_Den_of_Onis_21 era: XP: 70 GPV: fog: shroud: observers: shuffle: timer: 20120326 12:20:00< lobby> Fuzzlewhack ended game: "SKS’s game" (8552) at turn: 21 with reason: 'aborted' and disconnected. (socket: 13076) 20120326 12:20:05< tuxlobby> 20120326 12:20:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 12:20:22< lobby> KalenzZ started game: "Jeu de KalenzZ" (8877) with: KalenzZ. Settings: map: SXRPG TheEvilDead era: Ageless RPG Era XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 12:20:29< lobby> Quentin_ started game: "Quentin_ のゲーム" (8876) with: Quentin_, MEsoulDIC. Settings: map: RBY Custom 9 era: RBY No Mirror XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 12:20:33< lobby> Quentin_ advanced game: "Quentin_ のゲーム" (8876) with: Quentin_, MEsoulDIC. Settings: map: RBY The Freelands 21 era: XP: 70 GPV: fog: shroud: observers: shuffle: timer: 20120326 12:21:14< lobby> Siline started game: "Siline的游戏" (8878) with: Siline. Settings: map: 3pSurvival era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 12:21:18< lobby> Siline ended game: "Siline的游戏" (8878) at turn: 1 with reason: 'aborted'. (socket: 13598) 20120326 12:22:24< dicplobby> 20120326 12:22:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 12:22:47< lobby> pleiteseinistok started game: "pleiteseinistoks Partie" (8880) with: pleiteseinistok. Settings: map: multiplayer_Merkwuerdigliebe era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 12:23:42< lobby> Neuromancer ended game: "Can you defeat mighty Drakes? 510 reservoir" (8875) at turn: 2 with reason: 'aborted'. (socket: 13579) 20120326 12:23:46< lobby> KalenzZ ended game: "Jeu de KalenzZ" (8877) at turn: 73 with reason: 'aborted'. (socket: 13573) 20120326 12:24:21< lobby> KalenzZ started game: "Jeu de KalenzZ" (8884) with: KalenzZ. Settings: map: SXRPG TheEvilDead era: Ageless RPG Era XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 12:24:30< lobby> 20120326 12:24:30 Statistics: number_of_games = 26 number_of_users = 92 lobby_users = 21 20120326 12:25:05< tuxlobby> 20120326 12:25:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 12:25:18< lobby> SuicideGirl ended game: "I am seriously non-F'N-beatable. Get humiliated" (8816) at turn: 13 with reason: 'aborted'. (socket: 13378) 20120326 12:26:15< lobby> Atasco started game: "Atasco’s game" (8882) with: Atasco, Ryu, 27pyc, k-yu. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 12:26:31< lobby> ColdxWaveGER started game: "ColdxWaveGERs Partie" (8883) with: ColdxWaveGER, Slavik. Settings: map: Heroic_Last_Stand_scenario era: Heroic_Last_Stand_era XP: 30 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 12:26:39< lobby> Slavik ended game: "ColdxWaveGERs Partie" (8883) at turn: 1 with reason: 'aborted'. (socket: 13527) 20120326 12:27:24< dicplobby> 20120326 12:27:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 12:28:38< lobby> jurij jestes 20120326 12:28:58< lobby> Anus ended game: "MuDuck" (8839) at turn: 16 with reason: 'game over'. (socket: 13528) 20120326 12:29:30< lobby> 20120326 12:29:30 Statistics: number_of_games = 24 number_of_users = 93 lobby_users = 21 20120326 12:30:06< tuxlobby> 20120326 12:30:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 12:30:47< lobby> Neuromancer started game: "Neuromancer’s game" (8887) with: Neuromancer, Oli, Mack2rr, Buff. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 12:32:25< dicplobby> 20120326 12:32:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 12:32:58< lobby> pleiteseinistok ended game: "pleiteseinistoks Partie" (8880) at turn: 13 with reason: 'game over'. (socket: 13539) 20120326 12:32:58< lobby> Ksenia started game: "Ksenias Partie" (8889) with: Ksenia, Wrykolakas, Slavik. Settings: map: 3pSurvival era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 12:33:17< lobby> pleiteseinistok started game: "pleiteseinistoks Partie" (8890) with: pleiteseinistok. Settings: map: multiplayer_Merkwuerdigliebe era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 12:33:45< lobby> JC-D ended game: "RANDOM ONLY - XP30% - Free for all !" (8843) at turn: 16 with reason: 'game over'. (socket: 13506) 20120326 12:34:30< lobby> 20120326 12:34:30 Statistics: number_of_games = 24 number_of_users = 97 lobby_users = 25 20120326 12:35:03< lobby> SuicideGirl started game: "I am seriousy non-F'N-beatabe. Get humiliated" (8886) with: SuicideGirl, Solid_Snake, Noir. Settings: map: multiplayer_Clash era: era_default XP: 90 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 12:35:06< tuxlobby> 20120326 12:35:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 12:35:33< lobby> Solid_Snake ended game: "I am seriousy non-F'N-beatabe. Get humiliated" (8886) at turn: 1 with reason: 'aborted'. (socket: 13608) 20120326 12:36:01< lobby> M_aX started game: "Gra użytkownika M_aX" (8891) with: M_aX, Noir. Settings: map: multiplayer_2p_Dark_Forecast era: Dov_XP_Mod XP: 100 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 12:37:24< dicplobby> 20120326 12:37:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 12:37:39< lobby> janga started game: "Battaglia di janga" (8892) with: janga, xGalenx, GroberKeiler. Settings: map: 3pSurvival era: Ageless Era XP: 60 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 12:38:43< lobby> RedGlorfindel ended game: "RedGlorfindels Partie" (8842) at turn: 36 with reason: 'game over'. (socket: 13538) 20120326 12:39:30< lobby> 20120326 12:39:30 Statistics: number_of_games = 25 number_of_users = 92 lobby_users = 23 20120326 12:39:31< lobby> KalenzZ ended game: "Jeu de KalenzZ" (8884) at turn: 79 with reason: 'aborted'. (socket: 13573) 20120326 12:40:05< tuxlobby> 20120326 12:40:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 12:40:08< lobby> KalenzZ started game: "Jeu de KalenzZ" (8895) with: KalenzZ. Settings: map: SXRPG TheEvilDead era: Ageless RPG Era XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 12:40:15< lobby> abhijit ended game: "shapeshifter’s game" (8862) at turn: 6 with reason: 'aborted'. (socket: 13427) 20120326 12:40:38< lobby> Quentin_ ended game: "Quentin_ のゲーム" (8876) at turn: 5 with reason: 'game over'. (socket: 13586) 20120326 12:42:09< lobby> pleiteseinistok ended game: "pleiteseinistoks Partie" (8890) at turn: 13 with reason: 'game over'. (socket: 13539) 20120326 12:42:24< dicplobby> 20120326 12:42:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 12:42:35< lobby> Noir ended game: "Gra użytkownika M_aX" (8891) at turn: 7 with reason: 'aborted'. (socket: 13535) 20120326 12:43:11< lobby> Tobain ended game: "All random" (8845) at turn: 26 with reason: 'aborted'. (socket: 13470) 20120326 12:43:17< lobby> ufn ended game: "reloaded game for ufn" (8848) at turn: 19 with reason: 'game over'. (socket: 13444) 20120326 12:43:29< lobby> Wrykolakas ended game: "Ksenias Partie" (8889) at turn: 6 with reason: 'aborted'. (socket: 13389) 20120326 12:44:20< lobby> pleiteseinistok started game: "pleiteseinistoks Partie" (8899) with: pleiteseinistok. Settings: map: multiplayer_8p_Morituri era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 12:44:30< lobby> 20120326 12:44:30 Statistics: number_of_games = 22 number_of_users = 84 lobby_users = 23 20120326 12:45:05< tuxlobby> 20120326 12:45:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 12:46:01< lobby> M_aX started game: "Gra użytkownika M_aX" (8901) with: M_aX, Noir. Settings: map: multiplayer_2p_Dark_Forecast era: Dov_XP_Mod XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 12:46:25< lobby> Calandryl started game: "Calandryl’s game" (8900) with: Calandryl, Neuromancer, vector, armagedoom. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 12:47:24< dicplobby> 20120326 12:47:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 12:48:31< lobby> KalenzZ ended game: "Jeu de KalenzZ" (8895) at turn: 81 with reason: 'aborted'. (socket: 13573) 20120326 12:49:08< lobby> KalenzZ started game: "Jeu de KalenzZ" (8902) with: KalenzZ. Settings: map: SXRPG TheEvilDead era: Ageless RPG Era XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 12:49:30< lobby> 20120326 12:49:30 Statistics: number_of_games = 23 number_of_users = 88 lobby_users = 23 20120326 12:50:05< tuxlobby> 20120326 12:50:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 12:50:10< lobby> noob-killer ended game: "Applethree’s game" (8851) at turn: 30 with reason: 'aborted'. (socket: 13474) 20120326 12:50:11< lobby> anyone make a room for a noob? 20120326 12:50:42< lobby> shapeshifter started game: "shapeshifter’s game" (8896) with: shapeshifter, abhijit, hay206. Settings: map: World_Conquest_Start era: era_default XP: 80 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 12:52:24< dicplobby> 20120326 12:52:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 12:53:58< lobby> KalenzZ ended game: "Jeu de KalenzZ" (8902) at turn: 81 with reason: 'aborted'. (socket: 13573) 20120326 12:54:16< lobby> basiir started game: "basiir’s game -SENIOR, MAKE SURE YOU ARE PRO PLAYER" (8903) with: basiir, Slavik, Marem, Tobain. Settings: map: Colosseum_scenario era: Ageless RPG Era XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 12:54:30< lobby> 20120326 12:54:30 Statistics: number_of_games = 22 number_of_users = 85 lobby_users = 23 20120326 12:54:33< lobby> KalenzZ started game: "Jeu de KalenzZ" (8906) with: KalenzZ. Settings: map: SXRPG TheEvilDead era: Ageless RPG Era XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 12:54:51< lobby> DroppedConnection ended game: "basiir’s game" (8835) at turn: 42 with reason: 'aborted'. (socket: 13606) 20120326 12:55:05< tuxlobby> 20120326 12:55:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 12:55:11< lobby> M_aX ended game: "Gra użytkownika M_aX" (8901) at turn: 12 with reason: 'aborted'. (socket: 13629) 20120326 12:55:11< lobby> Tobain ended game: "basiir’s game -SENIOR, MAKE SURE YOU ARE PRO PLAYER" (8903) at turn: 1 with reason: 'aborted'. (socket: 13470) 20120326 12:55:58< lobby> basiir started game: "basiir’s game" (8907) with: basiir, Slavik, Marem, Tobain. Settings: map: Colosseum_scenario era: Ageless RPG Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 12:57:06< lobby> ferun started game: "Jeu de ferun" (8909) with: ferun, pfgtre. Settings: map: multiplayer_Basilisk era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 12:57:25< dicplobby> 20120326 12:57:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 12:59:17< lobby> pleiteseinistok ended game: "pleiteseinistoks Partie" (8899) at turn: 17 with reason: 'game over'. (socket: 13539) 20120326 12:59:30< lobby> 20120326 12:59:30 Statistics: number_of_games = 21 number_of_users = 81 lobby_users = 22 20120326 12:59:44< lobby> pleiteseinistok started game: "pleiteseinistoks Partie" (8911) with: pleiteseinistok. Settings: map: multiplayer_8p_Mokena_Prairie era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 13:00:05< tuxlobby> 20120326 13:00:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 13:00:21< dicplobby> Simonstre has logged on. (socket: 66) 20120326 13:00:24< dicplobby> Simonstre has logged off. (socket: 66) 20120326 13:02:01< lobby> ufn started game: "join have fun " (8910) with: ufn, Noir, loneranger, Prokon. Settings: map: Survival_Fusion_2 era: era_default XP: 150 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 13:02:24< dicplobby> 20120326 13:02:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 13:02:57< lobby> marcello started game: "Battaglia di marcello" (8913) with: marcello, Miguel. Settings: map: multiplayer_Hamlets era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 13:03:01< lobby> Coleatus started game: "Coleatuss Partie" (8912) with: Coleatus, Halunke. Settings: map: multiplayer_Crusaders_Field era: era_magic_0.18.0 XP: 50 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 13:03:17< lobby> KisukeUrahara started game: "Battaglia di KisukeUrahara" (8914) with: KisukeUrahara, Slealista. Settings: map: multiplayer_4p_Morituri era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 13:04:30< lobby> 20120326 13:04:30 Statistics: number_of_games = 26 number_of_users = 88 lobby_users = 22 20120326 13:05:05< tuxlobby> 20120326 13:05:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 13:05:20< lobby> Agra started game: "Gra użytkownika Agra" (8915) with: Agra, CRAZYpotato. Settings: map: vs_Survival_2p era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 13:07:24< dicplobby> 20120326 13:07:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 13:07:50< lobby> loneranger ended game: "join have fun " (8910) at turn: 1 with reason: 'aborted'. (socket: 13650) 20120326 13:09:30< lobby> 20120326 13:09:30 Statistics: number_of_games = 24 number_of_users = 84 lobby_users = 25 20120326 13:10:05< tuxlobby> 20120326 13:10:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 13:12:25< dicplobby> 20120326 13:12:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 13:13:11< lobby> Trigramatic ended game: "bluewolf27’s game" (8822) at turn: 33 with reason: 'game over'. (socket: 13204) 20120326 13:14:30< lobby> 20120326 13:14:30 Statistics: number_of_games = 24 number_of_users = 80 lobby_users = 23 20120326 13:14:43< lobby> pleiteseinistok ended game: "pleiteseinistoks Partie" (8911) at turn: 16 with reason: 'game over'. (socket: 13539) 20120326 13:15:02< lobby> pleiteseinistok started game: "pleiteseinistoks Partie" (8918) with: pleiteseinistok. Settings: map: multiplayer_Crusaders_Field era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 13:15:05< tuxlobby> 20120326 13:15:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 13:15:24< lobby> evea started game: "evea’s game" (8920) with: evea. Settings: map: 3pSurvival era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 13:16:02< lobby> moonchild ended game: "ISAR no noobs plz" (8803) at turn: 22 with reason: 'aborted'. (socket: 13349) 20120326 13:17:03< lobby> JC-D started game: "RANDOM ONLY - XP30% - Free for all !" (8917) with: JC-D, kirin, Slavik, mortalenemy. Settings: map: user_map era: era_default XP: 30 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 13:17:24< dicplobby> 20120326 13:17:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 13:18:18< lobby> evea ended game: "evea’s game" (8920) at turn: 2 with reason: 'aborted'. (socket: 13663) 20120326 13:18:45< lobby> Neuromancer started game: "Neuromancer’s game" (8919) with: Neuromancer, Prokon, evea, Mack2rr. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 13:18:47< lobby> janga ended game: "Battaglia di janga" (8892) at turn: 12 with reason: 'aborted'. (socket: 13620) 20120326 13:18:50< lobby> 3p survival anyone? 20120326 13:19:00< lobby> hi everybody 20120326 13:19:15< lobby> hi somebody! 20120326 13:19:30< lobby> 20120326 13:19:30 Statistics: number_of_games = 25 number_of_users = 77 lobby_users = 22 20120326 13:20:05< tuxlobby> 20120326 13:20:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 13:20:39< lobby> day ended game: "Игра Renegat" (8871) at turn: 17 with reason: 'aborted'. (socket: 13560) 20120326 13:20:43< lobby> janga started game: "Battaglia di janga" (8922) with: janga, Jaglavak, Rafo. Settings: map: 3pSurvival era: Ageless Era XP: 60 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 13:22:24< dicplobby> 20120326 13:22:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 13:22:28< lobby> Oli ended game: "Neuromancer’s game" (8887) at turn: 17 with reason: 'game over'. (socket: 13488) 20120326 13:23:03< lobby> enacui ended game: "Ladder" (8853) at turn: 17 with reason: 'game over'. (socket: 13588) 20120326 13:23:46< lobby> Cyberpilot started game: "Cyberpilot’s game" (8925) with: Cyberpilot. Settings: map: Colosseum_scenario era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 13:24:09< lobby> join ES battle 20120326 13:24:30< lobby> 20120326 13:24:30 Statistics: number_of_games = 23 number_of_users = 78 lobby_users = 30 20120326 13:24:47< lobby> pleiteseinistok ended game: "pleiteseinistoks Partie" (8918) at turn: 15 with reason: 'game over'. (socket: 13539) 20120326 13:25:05< tuxlobby> 20120326 13:25:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 13:25:05< lobby> pleiteseinistok started game: "pleiteseinistoks Partie" (8928) with: pleiteseinistok. Settings: map: multiplayer_Hexcake era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 13:25:20< lobby> finlandman44 started game: "ES battle" (8927) with: finlandman44. Settings: map: multiplayer_Random_Map_Desert era: era_default_ime_0.0.7a XP: 30 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 13:26:22< lobby> KalenzZ ended game: "Jeu de KalenzZ" (8906) at turn: 96 with reason: 'game over'. (socket: 13573) 20120326 13:26:45< lobby> xGalenx started game: "2 min each turn" (8924) with: xGalenx, RED_JOKER, orphen, Scatha. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 13:26:46< lobby> KisukeUrahara ended game: "Battaglia di KisukeUrahara" (8914) at turn: 9 with reason: 'aborted'. (socket: 13656) 20120326 13:27:24< dicplobby> 20120326 13:27:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 13:29:30< lobby> 20120326 13:29:30 Statistics: number_of_games = 24 number_of_users = 78 lobby_users = 28 20120326 13:29:42< lobby> WebbSeven started game: "WebbSeven's game" (8932) with: WebbSeven. Settings: map: (A New Land Classic)The Great Wall era: (A New Land Classic)A New Land:Expanded.0 XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 13:29:55< lobby> WebbSeven ended game: "WebbSeven's game" (8932) at turn: 1 with reason: 'aborted'. (socket: 13686) 20120326 13:30:05< tuxlobby> 20120326 13:30:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 13:30:48< lobby> WebbSeven started game: "WebbSeven's game" (8933) with: WebbSeven. Settings: map: (A New Land Classic)The Great Wall era: (A New Land Classic)A New Land:Expanded.0 XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 13:31:44< lobby> sanaris started game: "sanaris’s game (newb, rand)" (8930) with: sanaris, Slavik. Settings: map: RBY Adv + Con 10 era: RBY No Mirror XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 13:31:46< lobby> sanaris advanced game: "sanaris’s game (newb, rand)" (8930) with: sanaris, Slavik. Settings: map: RBY Elensefar Courtyard 12 era: XP: 70 GPV: fog: shroud: observers: shuffle: timer: 20120326 13:32:24< dicplobby> 20120326 13:32:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 13:33:52< lobby> pleiteseinistok ended game: "pleiteseinistoks Partie" (8928) at turn: 12 with reason: 'game over'. (socket: 13539) 20120326 13:33:54< lobby> prtfnx started game: "prtfnx’s game" (8935) with: prtfnx, MEsoulDIC. Settings: map: multiplayer_Weldyn_Channel era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 13:34:30< lobby> 20120326 13:34:30 Statistics: number_of_games = 24 number_of_users = 75 lobby_users = 25 20120326 13:34:43< lobby> k-yu ended game: "Atasco’s game" (8882) at turn: 14 with reason: 'game over'. (socket: 13466) 20120326 13:34:44< lobby> pleiteseinistok started game: "pleiteseinistoks Partie" (8937) with: pleiteseinistok. Settings: map: multiplayer_Forest_of_Fear era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 13:35:05< tuxlobby> 20120326 13:35:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 13:36:32< lobby> jpwrunyan started game: "noobs welcome" (8939) with: jpwrunyan, Cornelius. Settings: map: multiplayer_Fallenstar_Lake era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 13:36:41< lobby> WebbSeven ended game: "WebbSeven's game" (8933) at turn: 5 with reason: 'aborted'. (socket: 13686) 20120326 13:37:09< lobby> JC-D ended game: "RANDOM ONLY - XP30% - Free for all !" (8917) at turn: 10 with reason: 'aborted'. (socket: 13506) 20120326 13:37:25< dicplobby> 20120326 13:37:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 13:38:59< tuxlobby> reuven has logged on. (socket: 25230) 20120326 13:38:59< lobby> Cyberpilot ended game: "Cyberpilot’s game" (8925) at turn: 19 with reason: 'game over'. (socket: 13674) 20120326 13:39:06< tuxlobby> reuven has logged off. (socket: 25230) 20120326 13:39:30< lobby> 20120326 13:39:30 Statistics: number_of_games = 24 number_of_users = 78 lobby_users = 22 20120326 13:39:56< lobby> Atasco started game: "Atasco’s game" (8941) with: Atasco, Bobbay, drayko, kirin. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 13:40:05< tuxlobby> 20120326 13:40:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 13:40:55< lobby> Calandryl ended game: "Calandryl’s game" (8900) at turn: 7 with reason: 'aborted' and disconnected. (socket: 13617) 20120326 13:42:24< dicplobby> 20120326 13:42:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 13:42:26< lobby> finlandman44 ended game: "ES battle" (8927) at turn: 9 with reason: 'aborted'. (socket: 13668) 20120326 13:43:29< lobby> uro started game: "uro のゲーム" (8938) with: uro, isril, anna1991, Laela. Settings: map: Creep War v0.2.11.1 era: Ageless RPG Era XP: 60 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 13:44:30< lobby> 20120326 13:44:30 Statistics: number_of_games = 23 number_of_users = 77 lobby_users = 23 20120326 13:45:05< tuxlobby> 20120326 13:45:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 13:45:33< lobby> Miguel ended game: "Battaglia di marcello" (8913) at turn: 23 with reason: 'game over'. (socket: 13592) 20120326 13:46:42< lobby> pleiteseinistok ended game: "pleiteseinistoks Partie" (8937) at turn: 17 with reason: 'game over'. (socket: 13539) 20120326 13:46:59< lobby> pleiteseinistok started game: "pleiteseinistoks Partie" (8948) with: pleiteseinistok. Settings: map: multiplayer_Auction-X era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 13:47:24< dicplobby> 20120326 13:47:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 13:48:37< lobby> awaw started game: "awaw’s game" (8949) with: awaw, Krimzon. Settings: map: TL_WC_NM_Desert3 era: era_default XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 13:48:39< lobby> Zoldn ended game: "Игра Aksis" (8840) at turn: 26 with reason: 'aborted'. (socket: 13532) 20120326 13:49:30< lobby> 20120326 13:49:30 Statistics: number_of_games = 24 number_of_users = 76 lobby_users = 20 20120326 13:49:53< lobby> awaw advanced game: "awaw’s game" (8949) with: awaw, Krimzon. Settings: map: TL_WC_NM_Island4 era: XP: 80 GPV: fog: shroud: observers: shuffle: timer: 20120326 13:50:05< tuxlobby> 20120326 13:50:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 13:52:24< dicplobby> 20120326 13:52:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 13:52:48< lobby> JC-D started game: "RANDOM ONLY - XP30% - Free for all !" (8945) with: JC-D, Noir, WonderHenn, Slavik. Settings: map: user_map era: era_default XP: 30 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 13:53:30< lobby> SuicideGirl started game: "I am seriously non-F'N-beatable. Get humiliated" (8943) with: SuicideGirl, Solid_Snake, Emperor, okmo. Settings: map: multiplayer_Clash era: era_default XP: 90 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 13:54:30< lobby> 20120326 13:54:30 Statistics: number_of_games = 26 number_of_users = 77 lobby_users = 18 20120326 13:55:06< tuxlobby> 20120326 13:55:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 13:57:06< lobby> orphen started game: "Ladder" (8946) with: orphen, ufn. Settings: map: RBY Weldyn Channel 12 era: RBY No Mirror XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 13:57:24< dicplobby> 20120326 13:57:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 13:59:05< lobby> pleiteseinistok ended game: "pleiteseinistoks Partie" (8948) at turn: 18 with reason: 'game over'. (socket: 13539) 20120326 13:59:28< lobby> pleiteseinistok started game: "pleiteseinistoks Partie" (8953) with: pleiteseinistok. Settings: map: multiplayer_Xanthe_Chaos era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 13:59:30< lobby> 20120326 13:59:30 Statistics: number_of_games = 27 number_of_users = 80 lobby_users = 21 20120326 14:00:06< tuxlobby> 20120326 14:00:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 14:01:06< lobby> awaw ended game: "awaw’s game" (8949) at turn: 1 with reason: 'game over'. (socket: 13672) 20120326 14:02:09< lobby> blablabla started game: "Ladder" (8950) with: blablabla, widowmaker80. Settings: map: RMP_Classic era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 14:02:15< lobby> awaw started game: "awaw’s game" (8955) with: awaw, Krimzon. Settings: map: TL_WC_NM_Desert3 era: era_default XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 14:02:24< dicplobby> 20120326 14:02:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 14:02:38< lobby> blablabla advanced game: "Ladder" (8950) with: blablabla, widowmaker80. Settings: map: RMP_Sablestone_Delta_12 era: XP: 70 GPV: fog: shroud: observers: shuffle: timer: 20120326 14:03:14< lobby> awaw advanced game: "awaw’s game" (8955) with: awaw, Krimzon. Settings: map: TL_WC_NM_Island4 era: XP: 80 GPV: fog: shroud: observers: shuffle: timer: 20120326 14:03:37< lobby> shapeshifter advanced game: "shapeshifter’s game" (8896) with: shapeshifter, abhijit, hay206. Settings: map: TL_WC_NM_Island2 era: XP: 80 GPV: fog: shroud: observers: shuffle: timer: 20120326 14:04:49< lobby> 20120326 14:04:49 Statistics: number_of_games = 29 number_of_users = 88 lobby_users = 26 20120326 14:04:57< lobby> perh! ramai siot 20120326 14:05:05< tuxlobby> 20120326 14:05:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 14:05:24< lobby> awaw ended game: "awaw’s game" (8955) at turn: 1 with reason: 'game over'. (socket: 13672) 20120326 14:05:28< lobby> prtfnx ended game: "prtfnx’s game" (8935) at turn: 12 with reason: 'aborted'. (socket: 13691) 20120326 14:05:44< lobby> awaw started game: "awaw’s game" (8959) with: awaw, Krimzon. Settings: map: TL_WC_NM_Desert3 era: era_default XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 14:06:21< lobby> awaw advanced game: "awaw’s game" (8959) with: awaw, Krimzon. Settings: map: TL_WC_NM_Island4 era: XP: 80 GPV: fog: shroud: observers: shuffle: timer: 20120326 14:06:30< lobby> 27pyc started game: "Игра 27pyc" (8960) with: 27pyc. Settings: map: 3pSurvival era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 14:06:33< lobby> Scatha ended game: "2 min each turn" (8924) at turn: 10 with reason: 'aborted'. (socket: 13660) 20120326 14:06:35< lobby> Agra started game: "Gra użytkownika Agra" (8952) with: Agra, anakedian, evea. Settings: map: 3pSurvival era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 14:06:43< lobby> Mack2rr ended game: "Neuromancer’s game" (8919) at turn: 11 with reason: 'aborted'. (socket: 13339) 20120326 14:07:01< lobby> Grigor started game: "Grigor’s game" (8957) with: Grigor, JohnGrey. Settings: map: summer era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 14:07:24< dicplobby> 20120326 14:07:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 14:08:20< lobby> xGalenx started game: "2 min each turn" (8961) with: xGalenx, Panfil-Ugly, Prokon, o_0. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 14:09:13< lobby> jpwrunyan started game: "jpwrunyan’s game" (8964) with: jpwrunyan. Settings: map: multiplayer_Fallenstar_Lake era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 14:09:34< lobby> Cornelius ended game: "noobs welcome" (8939) at turn: 15 with reason: 'game over'. (socket: 13684) 20120326 14:09:49< lobby> 20120326 14:09:49 Statistics: number_of_games = 29 number_of_users = 84 lobby_users = 23 20120326 14:10:05< tuxlobby> 20120326 14:10:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 14:10:52< lobby> pleiteseinistok ended game: "pleiteseinistoks Partie" (8953) at turn: 16 with reason: 'game over'. (socket: 13539) 20120326 14:11:11< lobby> pleiteseinistok started game: "pleiteseinistoks Partie" (8966) with: pleiteseinistok. Settings: map: multiplayer_Island_of_the_Horatii era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 14:11:59< lobby> X-Wolf03 started game: "X-Wolf03’s game" (8965) with: X-Wolf03, KLASHINKOOV, anna1991. Settings: map: 3pSurvival era: Dov_XP_Mod XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 14:12:24< dicplobby> 20120326 14:12:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 14:12:56< lobby> <6u4> huy sosi potom prosi 20120326 14:13:08< lobby> CRAZYpotato ended game: "Gra użytkownika Agra" (8915) at turn: 20 with reason: 'aborted'. (socket: 13437) 20120326 14:13:15< lobby> да уж) 20120326 14:13:36< lobby> Applethree started game: "Applethree’s game" (8962) with: Applethree, WhiteTiger. Settings: map: multiplayer_2p_Dark_Forecast era: era_default XP: 100 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 14:14:49< lobby> 20120326 14:14:49 Statistics: number_of_games = 28 number_of_users = 83 lobby_users = 20 20120326 14:15:05< tuxlobby> 20120326 14:15:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 14:16:01< lobby> <6u4> HOSTITE BLYAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 20120326 14:17:01< lobby> who want to play creep wars? 20120326 14:17:08< lobby> JC-D ended game: "RANDOM ONLY - XP30% - Free for all !" (8945) at turn: 11 with reason: 'aborted'. (socket: 13506) 20120326 14:17:13< lobby> <6u4> too long and boring 20120326 14:17:13< lobby> pleiteseinistok ended game: "pleiteseinistoks Partie" (8966) at turn: 11 with reason: 'game over'. (socket: 13539) 20120326 14:17:14< lobby> Marem ended game: "basiir’s game" (8907) at turn: 24 with reason: 'aborted'. (socket: 13659) 20120326 14:17:24< dicplobby> 20120326 14:17:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 14:17:31< lobby> pleiteseinistok started game: "pleiteseinistoks Partie" (8971) with: pleiteseinistok. Settings: map: multiplayer_Alirok_Marsh era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 14:17:35< lobby> uro ended game: "uro のゲーム" (8938) at turn: 9 with reason: 'aborted' and disconnected. (socket: 13690) 20120326 14:17:37< lobby> JC-D started game: "RANDOM ONLY - XP30% - Free for all !" (8969) with: JC-D, 6u4, Noir, Mack2rr. Settings: map: user_map era: era_default XP: 30 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 14:17:59< lobby> shapeshifter1 started game: "shapeshifter1’s game" (8970) with: shapeshifter1, abhijit, hay206. Settings: map: TL_WC_NM_Island2 era: era_default XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 14:19:49< lobby> 20120326 14:19:49 Statistics: number_of_games = 28 number_of_users = 83 lobby_users = 19 20120326 14:20:05< tuxlobby> 20120326 14:20:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 14:21:40< lobby> EpicFailGuy ended game: "EpicFailGuys Partie" (8830) at turn: 50 with reason: 'aborted'. (socket: 13511) 20120326 14:22:04< lobby> pleiteseinistok ended game: "pleiteseinistoks Partie" (8971) at turn: 9 with reason: 'game over'. (socket: 13539) 20120326 14:22:24< dicplobby> 20120326 14:22:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 14:22:55< lobby> Jaglavak ended game: "Battaglia di janga" (8922) at turn: 23 with reason: 'game over'. (socket: 13294) 20120326 14:24:31< lobby> sanaris ended game: "sanaris’s game (newb, rand)" (8930) at turn: 22 with reason: 'game over'. (socket: 13670) 20120326 14:24:49< lobby> 20120326 14:24:49 Statistics: number_of_games = 23 number_of_users = 79 lobby_users = 24 20120326 14:25:05< tuxlobby> 20120326 14:25:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 14:26:09< lobby> awaw ended game: "awaw’s game" (8959) at turn: 3 with reason: 'game over'. (socket: 13672) 20120326 14:26:35< lobby> awaw started game: "awaw’s game" (8978) with: awaw, Krimzon. Settings: map: TL_WC_NM_Island4 era: era_default XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 14:26:48< lobby> Emperor started game: "Emperor的游戏" (8975) with: Emperor. Settings: map: multiplayer_Isars_Cross era: Age_of_Dinosaurs XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 14:26:51< lobby> SuicideGirl ended game: "I am seriously non-F'N-beatable. Get humiliated" (8943) at turn: 6 with reason: 'aborted'. (socket: 13697) 20120326 14:27:24< dicplobby> 20120326 14:27:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 14:27:35< lobby> ALICESOFT started game: "VIP" (8974) with: ALICESOFT, yuki, vipsoba, ahai, BET. Settings: map: Dov_MP_Rumble3D era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 14:27:42< lobby> JohnGrey ended game: "Grigor’s game" (8957) at turn: 15 with reason: 'game over'. (socket: 13737) 20120326 14:27:53< lobby> Danpe started game: "nome de Danpe" (8977) with: Danpe. Settings: map: 3pSurvival era: era_default XP: 50 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 14:28:20< lobby> Grigor started game: "Grigor’s game" (8980) with: Grigor, JohnGrey. Settings: map: greenworld era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 14:28:35< lobby> 27pyc ended game: "Игра 27pyc" (8960) at turn: 12 with reason: 'game over'. (socket: 13733) 20120326 14:28:49< lobby> universe started game: "Jeu de universe" (8976) with: universe, Spyro, Agra. Settings: map: vs_Survival_3p era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 14:29:15< lobby> pfgtre ended game: "Jeu de ferun" (8909) at turn: 25 with reason: 'game over'. (socket: 13709) 20120326 14:29:36< lobby> shapeshifter ended game: "shapeshifter’s game" (8896) at turn: 2 with reason: 'game over' and disconnected. (socket: 13486) 20120326 14:29:39< lobby> 27pyc started game: "Игра 27pyc" (8981) with: 27pyc, Keither, SLAVA1. Settings: map: 3pSurvival era: Dov_XP_Mod XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 14:29:49< lobby> 20120326 14:29:49 Statistics: number_of_games = 23 number_of_users = 82 lobby_users = 26 20120326 14:30:05< tuxlobby> 20120326 14:30:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 14:30:44< lobby> anakedian ended game: "Gra użytkownika Agra" (8952) at turn: 4 with reason: 'aborted'. (socket: 13729) 20120326 14:31:44< lobby> StrassenkateR started game: "StrassenkateRs Partie ... all welcome ... cool dude game ...mkay ?" (8982) with: StrassenkateR, Spieler. Settings: map: multiplayer_Random_Map era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 14:32:24< dicplobby> 20120326 14:32:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 14:33:16< lobby> BET ended game: "VIP" (8974) at turn: 3 with reason: 'aborted'. (socket: 13764) 20120326 14:33:55< lobby> ALICESOFT started game: "VIP" (8985) with: ALICESOFT, vipsoba, BET, yuki, ahai. Settings: map: Dov_MP_Rumble3D era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 14:34:49< lobby> 20120326 14:34:49 Statistics: number_of_games = 26 number_of_users = 88 lobby_users = 25 20120326 14:35:05< tuxlobby> 20120326 14:35:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 14:36:41< lobby> danpe started game: "nome de danpe" (8989) with: danpe, Panfil-Ugly, evea. Settings: map: 3pSurvival era: era_default XP: 50 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 14:37:06< lobby> jpwrunyan ended game: "jpwrunyan’s game" (8964) at turn: 20 with reason: 'game over'. (socket: 13667) 20120326 14:37:24< dicplobby> 20120326 14:37:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 14:37:31< lobby> Halunke ended game: "Coleatuss Partie" (8912) at turn: 11 with reason: 'aborted'. (socket: 13652) 20120326 14:38:17< lobby> SuicideGirl started game: "I am seriously non-F'N-beatable. Get humiliated" (8988) with: SuicideGirl, Chode_Sauce, Meaxy6, artase. Settings: map: multiplayer_Clash era: era_default XP: 90 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 14:38:32< lobby> Panfil-Ugly ended game: "nome de danpe" (8989) at turn: 1 with reason: 'aborted'. (socket: 13730) 20120326 14:38:33< lobby> jpwrunyan started game: "jpwrunyan’s game" (8991) with: jpwrunyan. Settings: map: multiplayer_Hamlets era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 14:39:19< lobby> Applethree ended game: "Applethree’s game" (8962) at turn: 18 with reason: 'aborted'. (socket: 13728) 20120326 14:39:29< lobby> Creon started game: "Creon’s game" (8993) with: Creon, Panfil-Ugly. Settings: map: RBY Weldyn Channel 12 era: RBY No Mirror XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 14:39:49< lobby> 20120326 14:39:49 Statistics: number_of_games = 25 number_of_users = 95 lobby_users = 31 20120326 14:39:50< lobby> Lukian started game: "Lukians Partie" (8987) with: Lukian, hantau, kamil, Marem, Noir. Settings: map: SXRPG CastleOfCantar era: era_default XP: 130 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 14:40:05< tuxlobby> 20120326 14:40:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 14:40:14< lobby> i got kicked off 20120326 14:40:41< lobby> xGalenx started game: "2 min each turn" (8996) with: xGalenx, 0_o, ioubaby, evea. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 14:40:45< lobby> card loading error 20120326 14:41:17< lobby> Umboione started game: "Battaglia di Umboione" (8994) with: Umboione, jin, Xelthor, Applethree. Settings: map: multiplayer_Clash era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 14:41:31< lobby> Mack2rr ended game: "RANDOM ONLY - XP30% - Free for all !" (8969) at turn: 8 with reason: 'game over'. (socket: 13339) 20120326 14:42:24< dicplobby> 20120326 14:42:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 14:42:43< lobby> Emperor ended game: "Emperor的游戏" (8975) at turn: 11 with reason: 'aborted'. (socket: 13702) 20120326 14:43:20< lobby> Emperor started game: "Emperor的游戏" (8999) with: Emperor. Settings: map: multiplayer_Isars_Cross era: Era Of Nonsense XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 14:43:32< lobby> Emperor ended game: "Emperor的游戏" (8999) at turn: 1 with reason: 'aborted'. (socket: 13702) 20120326 14:44:38< lobby> kirin ended game: "Atasco’s game" (8941) at turn: 15 with reason: 'game over'. (socket: 13651) 20120326 14:44:45< lobby> kamil ended game: "Lukians Partie" (8987) at turn: 1 with reason: 'aborted'. (socket: 13778) 20120326 14:44:49< lobby> 20120326 14:44:49 Statistics: number_of_games = 29 number_of_users = 90 lobby_users = 29 20120326 14:45:02< lobby> WhiteTiger started game: "Frranz" (9002) with: WhiteTiger, franz1. Settings: map: multiplayer_Den_of_Onis era: era_eeaw_1.5.2 XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 14:45:05< tuxlobby> 20120326 14:45:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 14:45:52< lobby> Emperor started game: "Emperor的游戏" (9004) with: Emperor, kelenz, anakedian. Settings: map: Dov_MP_Orocia era: Ageless Heroes XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 14:46:04< lobby> Atasco started game: "Atasco’s game" (9005) with: Atasco, k-yu, majo, Tobe. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 14:46:05< lobby> danpe started game: "nome de danpe" (9006) with: danpe. Settings: map: 3pSurvival era: era_default XP: 50 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 14:46:46< lobby> JC-D started game: "Long game! No leavers !" (9000) with: JC-D, Oli, Prokon, kickass. Settings: map: multiplayer_Auction-X era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 14:47:24< dicplobby> 20120326 14:47:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 14:47:53< lobby> Danpe ended game: "nome de Danpe" (8977) at turn: 3 with reason: 'aborted' and disconnected. (socket: 13765) 20120326 14:49:31< lobby> StrassenkateR ended game: "StrassenkateRs Partie ... all welcome ... cool dude game ...mkay ?" (8982) at turn: 10 with reason: 'game over'. (socket: 13762) 20120326 14:49:49< lobby> 20120326 14:49:49 Statistics: number_of_games = 27 number_of_users = 91 lobby_users = 22 20120326 14:50:05< tuxlobby> 20120326 14:50:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 14:50:38< lobby> jpwrunyan ended game: "jpwrunyan’s game" (8991) at turn: 10 with reason: 'game over'. (socket: 13667) 20120326 14:50:51< lobby> blablabla ended game: "Ladder" (8950) at turn: 14 with reason: 'game over'. (socket: 13706) 20120326 14:51:43< lobby> danpe ended game: "nome de danpe" (9006) at turn: 4 with reason: 'aborted'. (socket: 13804) 20120326 14:51:50< lobby> Sakatukitukasa started game: "Ladder(registed only)" (8998) with: Sakatukitukasa, widowmaker80. Settings: map: RMP_All era: RBY No Mirror XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 14:51:52< lobby> Sakatukitukasa advanced game: "Ladder(registed only)" (8998) with: Sakatukitukasa, widowmaker80. Settings: map: RMP_Den_of_Onis_12 era: XP: 70 GPV: fog: shroud: observers: shuffle: timer: 20120326 14:52:24< dicplobby> 20120326 14:52:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 14:54:49< lobby> 20120326 14:54:49 Statistics: number_of_games = 27 number_of_users = 92 lobby_users = 19 20120326 14:54:53< lobby> blablabla started game: "Ladder" (9012) with: blablabla, Inteliteknia. Settings: map: RMP_Classic era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 14:54:55< lobby> blablabla advanced game: "Ladder" (9012) with: blablabla, Inteliteknia. Settings: map: RMP_Hamlets_12 era: XP: 70 GPV: fog: shroud: observers: shuffle: timer: 20120326 14:55:05< lobby> PEPE-nr1 started game: " PEPE-nr1 i kamilek" (9014) with: PEPE-nr1, kamil. Settings: map: multiplayer_2p_Dark_Forecast era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 14:55:05< tuxlobby> 20120326 14:55:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 14:55:39< lobby> danpe started game: "nome de danpe" (9013) with: danpe, Mithril, Slippy. Settings: map: 3pSurvival era: era_default XP: 50 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 14:55:59< lobby> hire started game: "hire的游戏" (9010) with: hire, Spieler, StrassenkateR, Mateusz465. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 14:57:24< dicplobby> 20120326 14:57:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 14:59:49< lobby> 20120326 14:59:49 Statistics: number_of_games = 28 number_of_users = 95 lobby_users = 22 20120326 14:59:59< lobby> orphen ended game: "Ladder" (8946) at turn: 14 with reason: 'aborted'. (socket: 13676) 20120326 15:00:05< tuxlobby> 20120326 15:00:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 15:01:26< lobby> Inteliteknia ended game: "Ladder" (9012) at turn: 3 with reason: 'game over'. (socket: 13815) 20120326 15:01:43< lobby> blablabla started game: "Ladder" (9019) with: blablabla, Inteliteknia. Settings: map: RMP_Classic era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 15:01:45< lobby> blablabla advanced game: "Ladder" (9019) with: blablabla, Inteliteknia. Settings: map: RMP_Fallenstar_Lake_12 era: XP: 70 GPV: fog: shroud: observers: shuffle: timer: 20120326 15:02:24< dicplobby> 20120326 15:02:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 15:03:45< lobby> Droggelbecher started game: "Droggelbechers Partie" (9020) with: Droggelbecher. Settings: map: 3pSurvival era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 15:04:49< lobby> 20120326 15:04:49 Statistics: number_of_games = 28 number_of_users = 93 lobby_users = 22 20120326 15:05:05< tuxlobby> 20120326 15:05:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 15:05:25< lobby> Grigor ended game: "Grigor’s game" (8980) at turn: 25 with reason: 'game over'. (socket: 13731) 20120326 15:07:25< dicplobby> 20120326 15:07:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 15:07:38< lobby> Lukian started game: "Lukians Partie" (9016) with: Lukian, hantau, Daniel, kelenz, Dieu. Settings: map: SXRPG CastleOfCantar era: era_default XP: 130 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 15:07:44< lobby> Calandryl ended game: "2 min each turn" (8961) at turn: 6 with reason: 'aborted' and disconnected. (socket: 13753) 20120326 15:08:40< lobby> hantau ended game: "Lukians Partie" (9016) at turn: 1 with reason: 'aborted'. (socket: 13807) 20120326 15:08:54< lobby> wtf 20120326 15:09:05< lobby> yo 20120326 15:09:09< lobby> omaira 20120326 15:09:09< lobby> u have to load down the map first 20120326 15:09:12< lobby> Droggelbecher ended game: "Droggelbechers Partie" (9020) at turn: 3 with reason: 'aborted'. (socket: 13817) 20120326 15:09:19< lobby> vipper 20120326 15:09:49< lobby> 20120326 15:09:49 Statistics: number_of_games = 28 number_of_users = 97 lobby_users = 27 20120326 15:10:05< tuxlobby> 20120326 15:10:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 15:12:15< lobby> KLASHINKOOV ended game: "X-Wolf03’s game" (8965) at turn: 21 with reason: 'aborted'. (socket: 13744) 20120326 15:12:24< dicplobby> 20120326 15:12:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 15:13:25< lobby> Lukian started game: "Lukians Partie" (9023) with: Lukian, kkk, Para, KLASHINKOOV. Settings: map: SXRPG CastleOfCantar era: era_default XP: 130 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 15:13:30< lobby> WhiteTiger ended game: "Frranz" (9002) at turn: 23 with reason: 'game over'. (socket: 13745) 20120326 15:13:51< lobby> Ryu started game: "Battaglia di Ryu" (9022) with: Ryu, Dieu, The_Pathfinder, Rusty_Polok. Settings: map: multiplayer_Xanthe_Chaos era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 15:14:04< lobby> vipyojo started game: "vipyojo のゲーム" (9024) with: vipyojo, oyoyo, Syana. Settings: map: multiplayer_Alirok_Marsh era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 15:14:39< lobby> franz1 started game: "Franz EEaW League -www.milites.pl" (9028) with: franz1, WhiteTiger. Settings: map: multiplayer_Den_of_Onis era: era_eeaw_1.5.2 XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 15:14:49< lobby> 20120326 15:14:49 Statistics: number_of_games = 28 number_of_users = 98 lobby_users = 22 20120326 15:15:06< tuxlobby> 20120326 15:15:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 15:17:04< lobby> danpe started game: "nome de danpe" (9029) with: danpe, Oli, evea. Settings: map: 3pSurvival era: era_default XP: 50 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 15:17:24< dicplobby> 20120326 15:17:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 15:17:25< lobby> SilverMage started game: "SilverMage的游戏" (9031) with: SilverMage, jin. Settings: map: multiplayer_Basilisk era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 15:18:34< lobby> Para ended game: "Lukians Partie" (9023) at turn: 1 with reason: 'aborted'. (socket: 13835) 20120326 15:19:49< lobby> 20120326 15:19:49 Statistics: number_of_games = 32 number_of_users = 98 lobby_users = 21 20120326 15:20:06< tuxlobby> 20120326 15:20:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 15:20:38-!- Johannes13 [~Johannes@p4FDEBDAA.dip.t-dialin.net] has joined #wesnoth-mp-lobby-stable 20120326 15:20:39-!- Johannes13 [~Johannes@p4FDEBDAA.dip.t-dialin.net] has quit [Changing host] 20120326 15:20:39-!- Johannes13 [~Johannes@unaffiliated/johannes13] has joined #wesnoth-mp-lobby-stable 20120326 15:20:46< lobby> Slippy ended game: "nome de danpe" (9013) at turn: 14 with reason: 'game over'. (socket: 13816) 20120326 15:21:17< lobby> nikon started game: "Jeu de nikon" (9034) with: nikon, Tyrael, pelaaja, Camero. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 15:22:24< dicplobby> 20120326 15:22:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 15:22:41< lobby> Spyro ended game: "Jeu de universe" (8976) at turn: 14 with reason: 'aborted'. (socket: 13766) 20120326 15:23:11< lobby> Judge-dead started game: "Jeu de Judge-dead" (9039) with: Judge-dead. Settings: map: multiplayer_Aethermaw era: era_default XP: 60 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 15:23:13< lobby> yuki ended game: "VIP" (8985) at turn: 20 with reason: 'game over'. (socket: 13720) 20120326 15:23:30< lobby> tugi dousuru? 20120326 15:23:39< lobby> KalenzZ started game: "Jeu de KalenzZ" (9035) with: KalenzZ. Settings: map: World_Conquest_Start era: Ageless Heroes XP: 80 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 15:24:02< lobby> evea ended game: "nome de danpe" (9029) at turn: 3 with reason: 'aborted'. (socket: 13663) 20120326 15:24:04< lobby> Judge-dead ended game: "Jeu de Judge-dead" (9039) at turn: 1 with reason: 'aborted'. (socket: 13869) 20120326 15:24:36< lobby> dareka tateyo 20120326 15:24:49< lobby> 20120326 15:24:49 Statistics: number_of_games = 30 number_of_users = 96 lobby_users = 28 20120326 15:24:54< lobby> universe started game: "Jeu de universe" (9037) with: universe, Oli, evea. Settings: map: 3pSurvival era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 15:25:06< tuxlobby> 20120326 15:25:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 15:25:11< lobby> Judge-dead started game: "Jeu de Judge-dead" (9040) with: Judge-dead. Settings: map: multiplayer_2p_Dark_Forecast era: era_default XP: 50 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 15:25:21< lobby> kamil ended game: " PEPE-nr1 i kamilek" (9014) at turn: 7 with reason: 'aborted'. (socket: 13778) 20120326 15:25:30< lobby> Irmao-Verdade started game: "1 vs 1 two sides each" (9032) with: Irmao-Verdade, Landswellsong. Settings: map: multiplayer_4p_Underworld era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 15:25:30< lobby> makaseta 20120326 15:27:24< dicplobby> 20120326 15:27:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 15:28:10< lobby> ALICESOFT started game: "vip" (9047) with: ALICESOFT, ahai, BET, vipsoba. Settings: map: 2vs2Survival era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 15:28:24< lobby> PEPE started game: "Gra użytkownika PEPE" (9051) with: PEPE, kamil. Settings: map: multiplayer_2p_Dark_Forecast era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 15:29:37< lobby> prtfnx started game: "prtfnx’s game" (9043) with: prtfnx, rotny. Settings: map: multiplayer_Weldyn_Channel era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 15:29:49< lobby> 20120326 15:29:49 Statistics: number_of_games = 32 number_of_users = 99 lobby_users = 23 20120326 15:30:05< tuxlobby> 20120326 15:30:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 15:30:55< lobby> Tobe ended game: "Atasco’s game" (9005) at turn: 9 with reason: 'game over'. (socket: 13806) 20120326 15:31:19< lobby> 0_o ended game: "2 min each turn" (8996) at turn: 15 with reason: 'game over'. (socket: 13795) 20120326 15:32:23< lobby> capricorn started game: "capricorns Partie" (9055) with: capricorn, Iluminex. Settings: map: 2vs2Survival era: era_heroes XP: 30 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 15:32:25< dicplobby> 20120326 15:32:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 15:32:45< lobby> Applethree ended game: "Battaglia di Umboione" (8994) at turn: 11 with reason: 'aborted'. (socket: 13728) 20120326 15:32:46< lobby> Qtan started game: "Qtan のゲーム" (9056) with: Qtan, KLASHINKOOV. Settings: map: RBY Custom 9 era: RBY No Mirror XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 15:32:48< lobby> Qtan advanced game: "Qtan のゲーム" (9056) with: Qtan, KLASHINKOOV. Settings: map: RBY Hamlets 21 era: XP: 70 GPV: fog: shroud: observers: shuffle: timer: 20120326 15:33:36< lobby> Applethree started game: "Applethree’s game" (9057) with: Applethree, Bobbay. Settings: map: multiplayer_2p_Dark_Forecast era: era_default XP: 100 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 15:34:49< lobby> 20120326 15:34:49 Statistics: number_of_games = 32 number_of_users = 99 lobby_users = 24 20120326 15:35:05< tuxlobby> 20120326 15:35:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 15:37:24< dicplobby> 20120326 15:37:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 15:38:08< lobby> FadeToBlack ended game: "FadeToBlacks spel" (8863) at turn: 9 with reason: 'aborted'. (socket: 13565) 20120326 15:38:16< lobby> Krimzon ended game: "awaw’s game" (8978) at turn: 7 with reason: 'aborted'. (socket: 13708) 20120326 15:39:09< lobby> El_Gor ended game: "Игра El_Gor" (8860) at turn: 50 with reason: 'game over'. (socket: 13553) 20120326 15:39:28< lobby> pelaaja ended game: "Jeu de nikon" (9034) at turn: 5 with reason: 'game over'. (socket: 13859) 20120326 15:39:34< lobby> FadeToBlack started game: "FadeToBlacks spel" (9064) with: FadeToBlack, ShandorKing, 0_o, nikon. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 15:39:49< lobby> 20120326 15:39:49 Statistics: number_of_games = 31 number_of_users = 99 lobby_users = 26 20120326 15:40:05< tuxlobby> 20120326 15:40:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 15:42:24< dicplobby> 20120326 15:42:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 15:43:28< lobby> what? 20120326 15:44:49< lobby> 20120326 15:44:49 Statistics: number_of_games = 32 number_of_users = 101 lobby_users = 26 20120326 15:45:05< tuxlobby> 20120326 15:45:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 15:46:22< lobby> azzoole started game: "azzoole’s game" (9071) with: azzoole, fyul, Rusty_Polok. Settings: map: 3pSurvival era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 15:47:18< lobby> prtfnx ended game: "prtfnx’s game" (9043) at turn: 7 with reason: 'aborted'. (socket: 13868) 20120326 15:47:24< dicplobby> 20120326 15:47:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 15:48:57< lobby> prtfnx started game: "prtfnx’s game" (9075) with: prtfnx, khiM. Settings: map: multiplayer_Weldyn_Channel era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 15:49:22< lobby> SuicideGirl ended game: "I am seriously non-F'N-beatable. Get humiliated" (8988) at turn: 10 with reason: 'game over'. (socket: 13697) 20120326 15:49:49< lobby> 20120326 15:49:49 Statistics: number_of_games = 32 number_of_users = 102 lobby_users = 28 20120326 15:49:54< lobby> anakedian ended game: "Emperor的游戏" (9004) at turn: 14 with reason: 'aborted'. (socket: 13729) 20120326 15:49:59< lobby> franz1 ended game: "Franz EEaW League -www.milites.pl" (9028) at turn: 23 with reason: 'aborted'. (socket: 13785) 20120326 15:50:05< tuxlobby> 20120326 15:50:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 15:51:13< lobby> KalenzZ advanced game: "Jeu de KalenzZ" (9035) with: KalenzZ. Settings: map: TL_WC_NM_Island2 era: XP: 80 GPV: fog: shroud: observers: shuffle: timer: 20120326 15:51:48< lobby> Berethor started game: "Berethor’s game" (9066) with: Berethor, meiital. Settings: map: multiplayer_4p_Hamlets era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 15:52:14< lobby> SuicideGirl started game: "I am seriously non-F'N-beatable. Get humiiated" (9078) with: SuicideGirl, Maddog_Nutter, default, Roger. Settings: map: multiplayer_Clash era: era_default XP: 90 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 15:52:15< lobby> Lukian started game: "have to download SX RPG ADDON" (9072) with: Lukian, LuizBR, mutti, hantau. Settings: map: SXRPG CastleOfCantar era: era_default XP: 130 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 15:52:24< dicplobby> 20120326 15:52:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 15:52:39< lobby> KalenzZ ended game: "Jeu de KalenzZ" (9035) at turn: 1 with reason: 'game over'. (socket: 13813) 20120326 15:52:54< lobby> pleiteseinistok started game: "pleiteseinistoks Partie" (9082) with: pleiteseinistok. Settings: map: multiplayer_Auction-X era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 15:52:55< lobby> KalenzZ started game: "Jeu de KalenzZ" (9083) with: KalenzZ. Settings: map: TL_WC_NM_Island2 era: Ageless Heroes XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 15:53:01< lobby> KalenzZ ended game: "Jeu de KalenzZ" (9083) at turn: 1 with reason: 'aborted'. (socket: 13813) 20120326 15:53:10< lobby> prtfnx ended game: "prtfnx’s game" (9075) at turn: 3 with reason: 'aborted'. (socket: 13868) 20120326 15:53:14< lobby> KalenzZ started game: "Jeu de KalenzZ" (9084) with: KalenzZ. Settings: map: TL_WC_NM_Island2 era: Ageless Heroes XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 15:53:15< lobby> KalenzZ ended game: "Jeu de KalenzZ" (9084) at turn: 1 with reason: 'aborted'. (socket: 13813) 20120326 15:53:27< lobby> KalenzZ started game: "Jeu de KalenzZ" (9086) with: KalenzZ. Settings: map: TL_WC_NM_Island2 era: Ageless Heroes XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 15:53:32< lobby> KalenzZ ended game: "Jeu de KalenzZ" (9086) at turn: 1 with reason: 'aborted'. (socket: 13813) 20120326 15:53:44< lobby> KalenzZ started game: "Jeu de KalenzZ" (9087) with: KalenzZ. Settings: map: TL_WC_NM_Island2 era: Ageless Heroes XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 15:54:05< lobby> azzoole ended game: "azzoole’s game" (9071) at turn: 3 with reason: 'aborted'. (socket: 13903) 20120326 15:54:20< lobby> prtfnx started game: "prtfnx’s game" (9085) with: prtfnx, Emperor. Settings: map: multiplayer_Weldyn_Channel era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 15:54:49< lobby> 20120326 15:54:49 Statistics: number_of_games = 31 number_of_users = 101 lobby_users = 23 20120326 15:54:56< lobby> fredudu started game: "Jeu de fredudu" (9080) with: fredudu, Kahn_onjy_bryce. Settings: map: multiplayer_3p_Morituri era: Ageless Era XP: 30 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 15:55:05< tuxlobby> 20120326 15:55:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 15:55:15< lobby> abhijit ended game: "shapeshifter1’s game" (8970) at turn: 13 with reason: 'aborted'. (socket: 13427) 20120326 15:57:25< dicplobby> 20120326 15:57:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 15:57:34< lobby> azzoole started game: "azzoole’s game" (9088) with: azzoole, Scatha, kelenz. Settings: map: 3pSurvival era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 15:58:01< lobby> KLASHINKOOV ended game: "Qtan のゲーム" (9056) at turn: 13 with reason: 'game over'. (socket: 13890) 20120326 15:59:49< lobby> 20120326 15:59:49 Statistics: number_of_games = 30 number_of_users = 98 lobby_users = 25 20120326 16:00:05< tuxlobby> 20120326 16:00:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 16:02:24< dicplobby> 20120326 16:02:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 16:03:31< lobby> just4fun started game: "mad mode" (9092) with: just4fun, LuizBR, abhijit, KLASHINKOOV, shapeshifter. Settings: map: SXC_Rush_0.2.98 era: sxc_default_low_level_era XP: 130 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 16:04:49< lobby> 20120326 16:04:49 Statistics: number_of_games = 31 number_of_users = 101 lobby_users = 23 20120326 16:05:05< tuxlobby> 20120326 16:05:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 16:07:13< lobby> KLASHINKOOV started game: "KLASHINKOOV’s game" (9094) with: KLASHINKOOV, joelll, newkoas, ufn. Settings: map: multiplayer_Auction-X era: era_heroes XP: 60 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 16:07:22< lobby> Berethor ended game: "Berethor’s game" (9066) at turn: 2 with reason: 'aborted'. (socket: 13894) 20120326 16:07:24< dicplobby> 20120326 16:07:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 16:07:49< lobby> widowmaker80 ended game: "Ladder(registed only)" (8998) at turn: 19 with reason: 'game over'. (socket: 13445) 20120326 16:08:03< lobby> Atasco started game: "Atasco’s game" (9095) with: Atasco, danpe. Settings: map: multiplayer_Den_of_Onis era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 16:08:15< lobby> Sakatukitukasa started game: "ladder(registed only)" (9093) with: Sakatukitukasa, khiM. Settings: map: RMP_All era: RBY No Mirror XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 16:08:21< lobby> Sakatukitukasa advanced game: "ladder(registed only)" (9093) with: Sakatukitukasa, khiM. Settings: map: RMP_Astral_Port_12 era: XP: 70 GPV: fog: shroud: observers: shuffle: timer: 20120326 16:09:00< lobby> suiren started game: "yoyaku" (9096) with: suiren, orphen. Settings: map: RBY Custom 10 era: RBY No Mirror XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 16:09:01< lobby> suiren advanced game: "yoyaku" (9096) with: suiren, orphen. Settings: map: RBY The Freelands 21 era: XP: 70 GPV: fog: shroud: observers: shuffle: timer: 20120326 16:09:49< lobby> 20120326 16:09:49 Statistics: number_of_games = 30 number_of_users = 100 lobby_users = 23 20120326 16:10:01< lobby> mutti ended game: "have to download SX RPG ADDON" (9072) at turn: 1 with reason: 'aborted'. (socket: 13913) 20120326 16:10:05< tuxlobby> 20120326 16:10:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 16:12:00< lobby> hire ended game: "hire的游戏" (9010) at turn: 20 with reason: 'game over'. (socket: 13798) 20120326 16:12:24< dicplobby> 20120326 16:12:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 16:14:05< lobby> pleiteseinistok ended game: "pleiteseinistoks Partie" (9082) at turn: 29 with reason: 'game over'. (socket: 13922) 20120326 16:14:08< lobby> JC-D ended game: "Long game! No leavers !" (9000) at turn: 23 with reason: 'aborted'. (socket: 13506) 20120326 16:14:40< lobby> pleiteseinistok started game: "pleiteseinistoks Partie" (9099) with: pleiteseinistok. Settings: map: multiplayer_Merkwuerdigliebe era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 16:14:49< lobby> 20120326 16:14:49 Statistics: number_of_games = 27 number_of_users = 94 lobby_users = 25 20120326 16:15:05< tuxlobby> 20120326 16:15:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 16:17:24< dicplobby> 20120326 16:17:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 16:17:36< lobby> nikon ended game: "FadeToBlacks spel" (9064) at turn: 12 with reason: 'game over'. (socket: 13863) 20120326 16:19:49< lobby> 20120326 16:19:49 Statistics: number_of_games = 28 number_of_users = 92 lobby_users = 19 20120326 16:20:05< tuxlobby> 20120326 16:20:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 16:20:34< lobby> nikon started game: "Jeu de nikon" (9102) with: nikon, hire, ioubaby, k-yu. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 16:20:42< lobby> El_Gor started game: "Игра El_Gor" (9101) with: El_Gor, Dankovski, GrandFil. Settings: map: multiplayer_Random_Map era: Ageless Era XP: 30 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 16:21:55< lobby> KalenzZ ended game: "Jeu de KalenzZ" (9087) at turn: 7 with reason: 'aborted' and disconnected. (socket: 13813) 20120326 16:22:01< lobby> Dankovski ended game: "Игра El_Gor" (9101) at turn: 1 with reason: 'aborted'. (socket: 13559) 20120326 16:22:25< dicplobby> 20120326 16:22:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 16:22:46< lobby> Maddog_Nutter ended game: "I am seriously non-F'N-beatable. Get humiiated" (9078) at turn: 6 with reason: 'aborted'. (socket: 13916) 20120326 16:23:16< lobby> El_Gor started game: "Игра El_Gor" (9103) with: El_Gor, GrandFil, Dankovski. Settings: map: multiplayer_Random_Map era: Ageless Era XP: 30 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 16:23:24< lobby> pleiteseinistok ended game: "pleiteseinistoks Partie" (9099) at turn: 16 with reason: 'aborted'. (socket: 13922) 20120326 16:23:24< tuxlobby> Enin2 has logged on. (socket: 25231) 20120326 16:23:53< lobby> pleiteseinistok started game: "pleiteseinistoks Partie" (9104) with: pleiteseinistok. Settings: map: multiplayer_Merkwuerdigliebe era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 16:24:49< lobby> 20120326 16:24:49 Statistics: number_of_games = 27 number_of_users = 94 lobby_users = 22 20120326 16:25:05< tuxlobby> 20120326 16:25:05 Statistics: number_of_games = 0 number_of_users = 1 lobby_users = 1 20120326 16:25:14< tuxlobby> MUMUMUMUMUMUMMUMUMUMUMMUMMMMMUUUUUMMUMUMU 20120326 16:25:20< tuxlobby> VVKMVV has logged on. (socket: 25232) 20120326 16:25:50< tuxlobby> VVKMVV started game: "VVKMVV játéka" (15323) with: VVKMVV, Enin2. Settings: map: TL_WC_NM_Island2 era: era_default XP: GPV: fog: shroud: observers: no timer: 20120326 16:27:24< dicplobby> 20120326 16:27:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 16:27:43< lobby> KalenzZ started game: "Jeu de KalenzZ" (9106) with: KalenzZ. Settings: map: TL_WC_NM_Island2 era: Ageless Era XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 16:28:25< lobby> Bobbay ended game: "Applethree’s game" (9057) at turn: 27 with reason: 'aborted'. (socket: 13757) 20120326 16:28:37< lobby> abhijit ended game: "mad mode" (9092) at turn: 7 with reason: 'aborted'. (socket: 13427) 20120326 16:28:50< lobby> Inteliteknia ended game: "Ladder" (9019) at turn: 23 with reason: 'game over'. (socket: 13815) 20120326 16:29:39< lobby> icaros started game: "icaros’s game" (9108) with: icaros, Rusty_Polok, anakedian. Settings: map: ice era: Ageless Era XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 16:29:49< lobby> 20120326 16:29:49 Statistics: number_of_games = 28 number_of_users = 94 lobby_users = 27 20120326 16:30:05< tuxlobby> 20120326 16:30:05 Statistics: number_of_games = 1 number_of_users = 2 lobby_users = 0 20120326 16:30:29< lobby> Kahn_onjy_bryce ended game: "Jeu de fredudu" (9080) at turn: 12 with reason: 'game over'. (socket: 13914) 20120326 16:30:49< lobby> Irmao-Verdade ended game: "1 vs 1 two sides each" (9032) at turn: 11 with reason: 'out of sync'. (socket: 13858) 20120326 16:31:37< lobby> just4fun started game: "mad mode" (9109) with: just4fun, LuizBR, abhijit, hay206, shapeshifter. Settings: map: SXC_Rush_0.2.98 era: sxc_default_low_level_era XP: 130 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 16:31:48< tuxlobby> VVKMVV has left game: "VVKMVV játéka" (15323) and disconnected. (socket: 25232) 20120326 16:31:59< tuxlobby> Enin2 ended game: "VVKMVV játéka" (15323) at turn: 4 with reason: 'aborted'. (socket: 25231) 20120326 16:32:24< dicplobby> 20120326 16:32:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 16:32:49< tuxlobby> VVKMVV2 has logged on. (socket: 25233) 20120326 16:32:51< tuxlobby> Mircy Mircy 20120326 16:32:55< tuxlobby> Tölsd 20120326 16:32:59< lobby> Emperor ended game: "prtfnx’s game" (9085) at turn: 13 with reason: 'aborted'. (socket: 13923) 20120326 16:33:15< tuxlobby> VVKMVV2 started game: "VVKMVV2 játéka" (15324) with: VVKMVV2, Enin2. Settings: map: TL_WC_NM_Island2 era: era_default XP: GPV: fog: shroud: observers: no timer: 20120326 16:33:38< tuxlobby> Enin2 ended game: "VVKMVV2 játéka" (15324) at turn: 4 with reason: 'aborted'. (socket: 25231) 20120326 16:33:55< tuxlobby> VVKMVV2 started game: "VVKMVV2 játéka" (15325) with: VVKMVV2, Enin2. Settings: map: TL_WC_NM_Island2 era: era_default XP: GPV: fog: shroud: observers: no timer: 20120326 16:34:37< lobby> El_Gor ended game: "Игра El_Gor" (9103) at turn: 4 with reason: 'out of sync'. (socket: 13938) 20120326 16:34:41< lobby> SilverMage ended game: "SilverMage的游戏" (9031) at turn: 20 with reason: 'game over'. (socket: 13854) 20120326 16:34:45< lobby> SuicideGirl started game: "I am seriousy non-F'N-beatable. Get humiiated" (9112) with: SuicideGirl, Resident_Stevil, Emperor, xbriannova. Settings: map: multiplayer_Clash era: era_default XP: 90 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 16:34:49< lobby> 20120326 16:34:49 Statistics: number_of_games = 25 number_of_users = 83 lobby_users = 26 20120326 16:35:05< tuxlobby> 20120326 16:35:05 Statistics: number_of_games = 1 number_of_users = 2 lobby_users = 0 20120326 16:35:16< tuxlobby> Enin2 ended game: "VVKMVV2 játéka" (15325) at turn: 4 with reason: 'aborted'. (socket: 25231) 20120326 16:35:48< tuxlobby> VVKMVV2 started game: "VVKMVV2 játéka" (15326) with: VVKMVV2, Enin2. Settings: map: TL_WC_NM_Island2 era: era_default XP: GPV: fog: shroud: observers: no timer: 20120326 16:37:02-!- noy [~Noy@wesnoth/developer/noy] has joined #wesnoth-mp-lobby-stable 20120326 16:37:06-!- mode/#wesnoth-mp-lobby-stable [+o noy] by ChanServ 20120326 16:37:24< dicplobby> 20120326 16:37:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 16:37:39< lobby> just4fun started game: "mad mode " (9114) with: just4fun, LuizBR, abhijit, ssjshapeshifter2, Para. Settings: map: SXC_Rush_0.2.98 era: sxc_default_low_level_era XP: 130 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 16:37:51< lobby> anakedian ended game: "icaros’s game" (9108) at turn: 3 with reason: 'aborted'. (socket: 13729) 20120326 16:38:28< lobby> The_Pathfinder ended game: "Battaglia di Ryu" (9022) at turn: 18 with reason: 'game over'. (socket: 13840) 20120326 16:38:52< lobby> El_Gor started game: "Игра El_Gor" (9116) with: El_Gor, GrandFil, Dankovski. Settings: map: multiplayer_Random_Map era: Ageless Era XP: 30 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 16:39:10< lobby> op started game: "op的游戏" (9115) with: op, Tyrael, Prokon, Azazaa. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 16:39:10< lobby> ahai ended game: "vip" (9047) at turn: 16 with reason: 'game over'. (socket: 13724) 20120326 16:39:44< lobby> Judge-dead ended game: "Jeu de Judge-dead" (9040) at turn: 48 with reason: 'game over'. (socket: 13869) 20120326 16:39:49< lobby> 20120326 16:39:49 Statistics: number_of_games = 23 number_of_users = 80 lobby_users = 23 20120326 16:40:05< tuxlobby> 20120326 16:40:05 Statistics: number_of_games = 1 number_of_users = 2 lobby_users = 0 20120326 16:41:35< lobby> icaros started game: "icaros’s game" (9118) with: icaros, anakedian, kelenz. Settings: map: ice era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 16:42:16< lobby> Creon ended game: "Creon’s game" (8993) at turn: 41 with reason: 'game over'. (socket: 13769) 20120326 16:42:24< dicplobby> 20120326 16:42:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 16:43:47< lobby> pleiteseinistok ended game: "pleiteseinistoks Partie" (9104) at turn: 25 with reason: 'game over'. (socket: 13922) 20120326 16:44:49< lobby> 20120326 16:44:49 Statistics: number_of_games = 21 number_of_users = 79 lobby_users = 24 20120326 16:45:06< tuxlobby> 20120326 16:45:05 Statistics: number_of_games = 1 number_of_users = 2 lobby_users = 0 20120326 16:47:25< dicplobby> 20120326 16:47:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 16:48:11< lobby> KalenzZ advanced game: "Jeu de KalenzZ" (9106) with: KalenzZ. Settings: map: TL_WC_NM_Desert3 era: XP: 80 GPV: fog: shroud: observers: shuffle: timer: 20120326 16:48:44< lobby> JC-D started game: "RANDOM ONLY - XP30% - Free for all !" (9105) with: JC-D, Jexo, brandonly, 0_o. Settings: map: user_map era: era_default XP: 30 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 16:48:55< lobby> 27pyc ended game: "Игра 27pyc" (8981) at turn: 39 with reason: 'aborted'. (socket: 13733) 20120326 16:49:09< lobby> anakedian ended game: "icaros’s game" (9118) at turn: 3 with reason: 'aborted'. (socket: 13729) 20120326 16:49:46< lobby> shapeshifter ended game: "mad mode" (9109) at turn: 1 with reason: 'aborted' and disconnected. (socket: 13925) 20120326 16:49:49< lobby> 20120326 16:49:49 Statistics: number_of_games = 19 number_of_users = 75 lobby_users = 22 20120326 16:49:54< tuxlobby> VVKMVV9 has logged on. (socket: 25234) 20120326 16:50:05< tuxlobby> Enin has logged on. (socket: 25235) 20120326 16:50:06< tuxlobby> 20120326 16:50:05 Statistics: number_of_games = 2 number_of_users = 4 lobby_users = 1 20120326 16:50:18< tuxlobby> VVKMVV9 started game: "VVKMVV9 játéka" (15327) with: VVKMVV9, Enin. Settings: map: TL_WC_NM_Island2 era: era_default XP: GPV: fog: shroud: observers: no timer: 20120326 16:50:50< lobby> ssjshapeshifter2 ended game: "mad mode " (9114) at turn: 1 with reason: 'aborted'. (socket: 13965) 20120326 16:51:02< tuxlobby> Enin3 has logged on. (socket: 25236) 20120326 16:51:04< tuxlobby> VVKMVV99999999 has logged on. (socket: 25237) 20120326 16:51:05< tuxlobby> MUMU 20120326 16:51:08< tuxlobby> ?????????? 20120326 16:51:13< tuxlobby> Fej fájás 20120326 16:51:27< tuxlobby> VVKMVV99999999 started game: "VVKMVV99999999 játéka" (15328) with: VVKMVV99999999, Enin3. Settings: map: TL_WC_NM_Island2 era: era_default XP: GPV: fog: shroud: observers: no timer: 20120326 16:52:19< lobby> just4fun started game: "mad hosting mode" (9121) with: just4fun, ssjshapeshifter2, kelenz, abhijit, icaros. Settings: map: SXC_Rush_0.2.98 era: sxc_default_low_level_era XP: 130 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 16:52:24< dicplobby> 20120326 16:52:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 16:54:18< lobby> Perseus started game: "Perseus’s game" (9124) with: Perseus, Roger, yep, aori. Settings: map: 2vs2Survival era: Dov_Drops_Mod XP: 50 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 16:54:49< lobby> 20120326 16:54:49 Statistics: number_of_games = 20 number_of_users = 88 lobby_users = 30 20120326 16:54:57< lobby> Sakatukitukasa ended game: "ladder(registed only)" (9093) at turn: 15 with reason: 'game over'. (socket: 13928) 20120326 16:55:05< tuxlobby> 20120326 16:55:05 Statistics: number_of_games = 3 number_of_users = 6 lobby_users = 0 20120326 16:55:35< lobby> Coleatus started game: "Coleatuss Partie" (9125) with: Coleatus, Halunke. Settings: map: multiplayer_Crusaders_Field era: era_magic_0.18.0 XP: GPV: fog: shroud: observers: no shuffle: no timer: 20120326 16:55:50< lobby> AxtImWalde started game: "AxtImWaldes Partie" (9126) with: AxtImWalde, Blainn. Settings: map: multiplayer_Random_Map era: Ageless Era XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 16:55:54< lobby> Xplorer started game: "Ladder - Xplorer" (9123) with: Xplorer, khiM. Settings: map: RBY Classic 8 era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 16:56:19< lobby> ksz started game: "f" (9127) with: ksz. Settings: map: Colosseum_scenario era: Colosseum_Extended_era XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 16:56:39< lobby> Xplorer advanced game: "Ladder - Xplorer" (9123) with: Xplorer, khiM. Settings: map: RBY Hamlets 12 era: XP: 70 GPV: fog: shroud: observers: shuffle: timer: 20120326 16:57:24< dicplobby> 20120326 16:57:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 16:57:47< lobby> marcello started game: "Battaglia di marcello" (9128) with: marcello, Patrizio, bibbo. Settings: map: multiplayer_Blue_Water_Province era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 16:58:08< lobby> Tyrael ended game: "op的游戏" (9115) at turn: 5 with reason: 'aborted'. (socket: 13967) 20120326 16:58:14< dicplobby> gracz has logged on. (socket: 68) 20120326 16:58:20< dicplobby> gracz has logged off. (socket: 68) 20120326 16:58:23< lobby> Clow started game: "Clows Partie" (9130) with: Clow. Settings: map: multiplayer_Hamlets era: Ageless Era XP: 30 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 16:58:34< lobby> bibbo ended game: "Battaglia di marcello" (9128) at turn: 1 with reason: 'aborted'. (socket: 13970) 20120326 16:58:52< lobby> anyoen up for a ladder game ? 20120326 16:58:56< lobby> WhiteTiger started game: "Game survival" (9129) with: WhiteTiger, Tim. Settings: map: multiplayer_2p_Dark_Forecast era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 16:59:07< lobby> me 20120326 16:59:12< lobby> Halunke ended game: "Coleatuss Partie" (9125) at turn: 12 with reason: 'aborted'. (socket: 13990) 20120326 16:59:49< lobby> 20120326 16:59:49 Statistics: number_of_games = 25 number_of_users = 97 lobby_users = 33 20120326 17:00:05< tuxlobby> 20120326 17:00:05 Statistics: number_of_games = 3 number_of_users = 6 lobby_users = 0 20120326 17:00:10< lobby> Coleatus started game: "Coleatuss Partie" (9134) with: Coleatus, Halunke. Settings: map: multiplayer_Crusaders_Field era: era_magic_0.18.0 XP: 50 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 17:00:15< lobby> gamelle started game: "Ladder for windowmaker80" (9136) with: gamelle, widowmaker80. Settings: map: RMP_Conservative Adventurous era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 17:00:50< lobby> gamelle advanced game: "Ladder for windowmaker80" (9136) with: gamelle, widowmaker80. Settings: map: RMP_Elensefar_Courtyard_12 era: XP: 70 GPV: fog: shroud: observers: shuffle: timer: 20120326 17:01:35< lobby> warlordalf started game: "quick - no noobs" (9137) with: warlordalf, hay206, screwtop, Prokon. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 17:02:24< dicplobby> 20120326 17:02:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 17:02:44< lobby> bibbo started game: "Battaglia di bibbo" (9131) with: bibbo, marcello, Patrizio, guidoc. Settings: map: multiplayer_Loris_River era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 17:04:49< lobby> 20120326 17:04:49 Statistics: number_of_games = 29 number_of_users = 101 lobby_users = 24 20120326 17:05:01< tuxlobby> Enin2 has left game: "VVKMVV2 játéka" (15326) and disconnected. (socket: 25231) 20120326 17:05:05< tuxlobby> 20120326 17:05:05 Statistics: number_of_games = 3 number_of_users = 5 lobby_users = 0 20120326 17:05:15< lobby> Velociraptor started game: "La partida de Velociraptor" (9141) with: Velociraptor, anakedian, Slavik. Settings: map: isars_blasphemy era: Ageless Era XP: 50 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 17:05:42< tuxlobby> VVKMVV2 ended game: "VVKMVV2 játéka" (15326) at turn: 6 with reason: 'aborted' and disconnected. (socket: 25233) 20120326 17:06:53< tuxlobby> Enin has left game: "VVKMVV9 játéka" (15327) and disconnected. (socket: 25235) 20120326 17:07:14< lobby> JC-D started game: "RANDOM ONLY - XP30% - Free for all !" (9142) with: JC-D, Azazaa, RickDangerous, Sioux. Settings: map: user_map era: era_default XP: 30 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 17:07:22< tuxlobby> VVKMVV9 ended game: "VVKMVV9 játéka" (15327) at turn: 6 with reason: 'aborted' and disconnected. (socket: 25234) 20120326 17:07:24< dicplobby> 20120326 17:07:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 17:07:38< lobby> anakedian ended game: "La partida de Velociraptor" (9141) at turn: 1 with reason: 'aborted'. (socket: 13729) 20120326 17:07:48< lobby> clap started game: "clap’s game" (9143) with: clap, Slavik. Settings: map: multiplayer_A_New_Land era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 17:07:51< lobby> Clow ended game: "Clows Partie" (9130) at turn: 9 with reason: 'game over'. (socket: 14010) 20120326 17:08:22< lobby> Velociraptor started game: "no noobs no quiter Velociraptor" (9145) with: Velociraptor, Kaentar, anakedian. Settings: map: isars_blasphemy era: Ageless Era XP: 50 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 17:08:46< lobby> Clow started game: "Clows Partie" (9147) with: Clow. Settings: map: multiplayer_Fallenstar_Lake era: Ageless Era XP: 30 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 17:09:15< lobby> _NiCo_ started game: "WC NIGHTMARE join if u have played this before" (9139) with: _NiCo_, skarlatus, Miguel. Settings: map: World_Conquest_Start era: era_default XP: 80 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 17:09:49< lobby> 20120326 17:09:49 Statistics: number_of_games = 31 number_of_users = 106 lobby_users = 24 20120326 17:10:05< tuxlobby> 20120326 17:10:05 Statistics: number_of_games = 1 number_of_users = 2 lobby_users = 0 20120326 17:10:26< lobby> RickDangerous ended game: "RANDOM ONLY - XP30% - Free for all !" (9142) at turn: 1 with reason: 'aborted'. (socket: 14021) 20120326 17:12:25< dicplobby> 20120326 17:12:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 17:12:42< lobby> Droggelbecher started game: "Droggelbechers Partie" (9150) with: Droggelbecher, JomskyPonsky, kil. Settings: map: 3pSurvival era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 17:14:09< lobby> JC-D started game: "RANDOM ONLY - XP30% - Free for all !" (9148) with: JC-D, Mywish, prasmal, Tortueman. Settings: map: user_map era: era_default XP: 30 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 17:14:20< lobby> Clow ended game: "Clows Partie" (9147) at turn: 9 with reason: 'game over'. (socket: 14010) 20120326 17:14:49< lobby> 20120326 17:14:49 Statistics: number_of_games = 33 number_of_users = 112 lobby_users = 23 20120326 17:15:01< lobby> Clow started game: "Clows Partie" (9153) with: Clow. Settings: map: multiplayer_Fallenstar_Lake era: Ageless Era XP: 30 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 17:15:05< tuxlobby> 20120326 17:15:05 Statistics: number_of_games = 1 number_of_users = 2 lobby_users = 0 20120326 17:15:07< lobby> Jexo ended game: "RANDOM ONLY - XP30% - Free for all !" (9105) at turn: 10 with reason: 'game over'. (socket: 13971) 20120326 17:15:36< lobby> MSKPL started game: "Gra użytkownika MSKPL" (9155) with: MSKPL, MaTi. Settings: map: multiplayer_Siege_Castles era: era_default XP: GPV: fog: shroud: observers: no shuffle: no timer: 20120326 17:16:12< lobby> Ishimi started game: "nome de Ishimi" (9154) with: Ishimi, jogador, Gorolanius. Settings: map: 3pSurvival era: era_default XP: 30 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 17:17:24< dicplobby> 20120326 17:17:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 17:17:41< lobby> Um started game: "Gra użytkownika Um" (9156) with: Um. Settings: map: multiplayer_Clash era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 17:17:43< lobby> Gorolanius ended game: "nome de Ishimi" (9154) at turn: 1 with reason: 'aborted'. (socket: 14031) 20120326 17:18:03-!- noy [~Noy@wesnoth/developer/noy] has quit [Quit: noy] 20120326 17:18:32< lobby> Ishimi started game: "nome de Ishimi" (9157) with: Ishimi, jogador, Gorolanius, Arthasss. Settings: map: 2vs2Survival era: era_default XP: 30 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 17:18:46< lobby> Gronomo started game: "1x1, 2kings each, random, no newb" (9158) with: Gronomo, zen. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 17:19:18< lobby> Um ended game: "Gra użytkownika Um" (9156) at turn: 1 with reason: 'aborted'. (socket: 14035) 20120326 17:19:39< lobby> Um started game: "Gra użytkownika Um" (9160) with: Um. Settings: map: multiplayer_Clash era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 17:19:49< lobby> 20120326 17:19:49 Statistics: number_of_games = 35 number_of_users = 111 lobby_users = 24 20120326 17:20:05< tuxlobby> 20120326 17:20:05 Statistics: number_of_games = 1 number_of_users = 2 lobby_users = 0 20120326 17:20:34< lobby> JomskyPonsky ended game: "Droggelbechers Partie" (9150) at turn: 4 with reason: 'aborted'. (socket: 13880) 20120326 17:21:09< lobby> Dankovski ended game: "Игра El_Gor" (9116) at turn: 11 with reason: 'out of sync'. (socket: 13559) 20120326 17:21:17< lobby> Velociraptor started game: "La partida de Velociraptor" (9162) with: Velociraptor. Settings: map: isars_blasphemy era: Ageless Era XP: 50 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 17:22:09< lobby> kamil ended game: "Gra użytkownika PEPE" (9051) at turn: 31 with reason: 'aborted'. (socket: 13778) 20120326 17:22:24< dicplobby> 20120326 17:22:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 17:22:37< lobby> Halunke ended game: "Coleatuss Partie" (9134) at turn: 7 with reason: 'aborted'. (socket: 13990) 20120326 17:22:39< tuxlobby> VVKMVV99999999 has logged off. (socket: 25237) 20120326 17:22:45< tuxlobby> Enin3 ended game: "VVKMVV99999999 játéka" (15328) at turn: 11 with reason: 'aborted'. (socket: 25236) 20120326 17:23:02< lobby> Atasco ended game: "Atasco’s game" (9095) at turn: 32 with reason: 'out of sync'. (socket: 13599) 20120326 17:23:10< lobby> Droggelbecher started game: "Droggelbechers Partie" (9161) with: Droggelbecher, JomskyPonsky, Wepawetmose. Settings: map: 3pSurvival era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 17:23:13< lobby> Clow ended game: "Clows Partie" (9153) at turn: 12 with reason: 'game over'. (socket: 14010) 20120326 17:23:36< tuxlobby> Enin3 has logged off. (socket: 25236) 20120326 17:23:41< lobby> Coleatus started game: "Coleatuss Partie" (9164) with: Coleatus, Halunke. Settings: map: multiplayer_Crusaders_Field era: era_magic_0.18.0 XP: 50 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 17:24:02< lobby> Clow started game: "Clows Partie" (9165) with: Clow. Settings: map: multiplayer_Fallenstar_Lake era: Ageless Era XP: 30 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 17:24:49< lobby> 20120326 17:24:49 Statistics: number_of_games = 34 number_of_users = 116 lobby_users = 32 20120326 17:25:05< tuxlobby> 20120326 17:25:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 17:26:30< lobby> Tovarish_Tufca started game: "Игра Tovarish_Tufca" (9167) with: Tovarish_Tufca, kkk, Sioux. Settings: map: 3pSurvival era: era_heroes XP: 60 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 17:27:23< lobby> michi323 started game: "michi323s Partie" (9169) with: michi323, Demon626. Settings: map: multiplayer_Hexcake era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 17:27:24< dicplobby> 20120326 17:27:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 17:27:34< lobby> AVISTA started game: "Gra użytkownika AVISTA" (9166) with: AVISTA, Slavik, newkoas, kelenz. Settings: map: Creep War New Map v0.2.11.1 era: Creep_Era_v0.2.11.1 XP: 50 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 17:28:43< lobby> Demon626 ended game: "michi323s Partie" (9169) at turn: 1 with reason: 'aborted'. (socket: 14064) 20120326 17:29:17< lobby> michi323 started game: "michi323s Partie" (9171) with: michi323, Demon626. Settings: map: multiplayer_Hexcake era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 17:29:47< lobby> Daemon started game: "Daemon’s game" (9172) with: Daemon, Denhonator. Settings: map: multiplayer_Hamlets era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 17:29:49< lobby> 20120326 17:29:49 Statistics: number_of_games = 37 number_of_users = 121 lobby_users = 32 20120326 17:30:05< tuxlobby> 20120326 17:30:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 17:30:07< lobby> Tortueman ended game: "RANDOM ONLY - XP30% - Free for all !" (9148) at turn: 7 with reason: 'game over'. (socket: 14042) 20120326 17:30:36< lobby> Applethree started game: "Applethree’s game" (9175) with: Applethree, Tortueman. Settings: map: multiplayer_2p_Dark_Forecast era: era_default XP: 100 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 17:31:11< lobby> Applethree ended game: "Applethree’s game" (9175) at turn: 1 with reason: 'aborted'. (socket: 13728) 20120326 17:31:15< lobby> JC-D started game: "RANDOM ONLY - XP30% - Free for all !" (9176) with: JC-D, kamil, Ikerpeta, Tortueman. Settings: map: user_map era: era_default XP: 30 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 17:32:07< lobby> Demon626 ended game: "michi323s Partie" (9171) at turn: 2 with reason: 'aborted'. (socket: 14064) 20120326 17:32:13< lobby> Clow ended game: "Clows Partie" (9165) at turn: 11 with reason: 'game over'. (socket: 14010) 20120326 17:32:24< dicplobby> 20120326 17:32:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 17:33:07< lobby> Sakatukitukasa started game: "ladder(registed only)" (9179) with: Sakatukitukasa, yzr. Settings: map: RMP_All era: RBY No Mirror XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 17:33:10< lobby> Sakatukitukasa advanced game: "ladder(registed only)" (9179) with: Sakatukitukasa, yzr. Settings: map: RMP_Aethermaw_21 era: XP: 70 GPV: fog: shroud: observers: shuffle: timer: 20120326 17:33:14< lobby> Clow started game: "Clows Partie" (9183) with: Clow. Settings: map: multiplayer_Fallenstar_Lake era: Ageless Era XP: 30 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 17:33:33< lobby> warlordalf ended game: "quick - no noobs" (9137) at turn: 5 with reason: 'aborted' and disconnected. (socket: 13987) 20120326 17:34:25< lobby> Sakatukitukasa ended game: "ladder(registed only)" (9179) at turn: 1 with reason: 'game over'. (socket: 13928) 20120326 17:34:27< lobby> KalenzZ ended game: "Jeu de KalenzZ" (9106) at turn: 7 with reason: 'game over'. (socket: 13951) 20120326 17:34:43< lobby> mtw169 started game: "mtw169s Partie" (9185) with: mtw169, Schattenklau. Settings: map: wultiplayer_Northerners_RPG era: era_heroes XP: GPV: fog: shroud: observers: no shuffle: no timer: 20120326 17:34:48< lobby> Sakatukitukasa started game: "ladder for yzr" (9186) with: Sakatukitukasa, yzr. Settings: map: RMP_All era: RBY No Mirror XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 17:34:49< lobby> 20120326 17:34:49 Statistics: number_of_games = 41 number_of_users = 121 lobby_users = 26 20120326 17:34:50< lobby> Sakatukitukasa advanced game: "ladder for yzr" (9186) with: Sakatukitukasa, yzr. Settings: map: RMP_Den_of_Onis_12 era: XP: 70 GPV: fog: shroud: observers: shuffle: timer: 20120326 17:35:05< tuxlobby> 20120326 17:35:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 17:35:07< lobby> michi323 started game: "michi323s Partie" (9182) with: michi323, Demon626. Settings: map: multiplayer_Hexcake era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 17:35:14< lobby> danpe started game: "nome de danpe" (9181) with: danpe, Prokon, k-yu. Settings: map: 3pSurvival era: era_default XP: 50 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 17:36:19< lobby> Applethree started game: "Applethree’s game" (9189) with: Applethree, JustynatheWiewiura. Settings: map: multiplayer_2p_Dark_Forecast era: era_default XP: 100 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 17:36:21< lobby> Velociraptor ended game: "La partida de Velociraptor" (9162) at turn: 11 with reason: 'aborted'. (socket: 14022) 20120326 17:36:32< lobby> anakedian ended game: "no noobs no quiter Velociraptor" (9145) at turn: 3 with reason: 'aborted' and disconnected. (socket: 13729) 20120326 17:36:42< lobby> jogador ended game: "nome de Ishimi" (9157) at turn: 4 with reason: 'aborted'. (socket: 14037) 20120326 17:37:18< lobby> Qtan started game: "Qtan のゲーム" (9184) with: Qtan, Inwa. Settings: map: RBY Custom 9 era: RBY No Mirror XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 17:37:19< lobby> Qtan advanced game: "Qtan のゲーム" (9184) with: Qtan, Inwa. Settings: map: RBY The Freelands 12 era: XP: 70 GPV: fog: shroud: observers: shuffle: timer: 20120326 17:37:25< dicplobby> 20120326 17:37:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 17:37:28< lobby> Ikerpeta started game: "La partida de Ikerpeta" (9187) with: Ikerpeta, reality. Settings: map: Conquest-Pasarganta era: Ageless Era XP: 100 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 17:38:36< lobby> Gronomo ended game: "1x1, 2kings each, random, no newb" (9158) at turn: 7 with reason: 'aborted'. (socket: 14048) 20120326 17:39:22< lobby> Soni started game: "hraje Soni" (9191) with: Soni, janga, kil. Settings: map: 3pSurvival era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 17:39:49< lobby> 20120326 17:39:49 Statistics: number_of_games = 43 number_of_users = 133 lobby_users = 28 20120326 17:39:53< lobby> Clow ended game: "Clows Partie" (9183) at turn: 10 with reason: 'game over'. (socket: 14010) 20120326 17:40:02< lobby> ioubaby ended game: "Jeu de nikon" (9102) at turn: 16 with reason: 'game over'. (socket: 13773) 20120326 17:40:05< tuxlobby> 20120326 17:40:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 17:40:09< lobby> _NiCo_ ended game: "WC NIGHTMARE join if u have played this before" (9139) at turn: 7 with reason: 'aborted'. (socket: 14018) 20120326 17:40:45< lobby> khiM ended game: "Ladder - Xplorer" (9123) at turn: 10 with reason: 'game over'. (socket: 13910) 20120326 17:41:11< lobby> Um ended game: "Gra użytkownika Um" (9160) at turn: 11 with reason: 'aborted'. (socket: 14035) 20120326 17:41:19< lobby> Clow started game: "Clows Partie" (9195) with: Clow. Settings: map: multiplayer_Hamlets era: Ageless Era XP: 30 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 17:41:34< lobby> jugador started game: "La partida de jugador" (9194) with: jugador, Dankovski. Settings: map: multiplayer_Cynsaun_Battlefield era: era_default XP: 40 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 17:41:40< lobby> _NiCo_ started game: "WC NIGHTMARE join if u have played this before" (9196) with: _NiCo_, Miguel, zen. Settings: map: World_Conquest_Start era: era_default XP: 80 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 17:42:24< dicplobby> 20120326 17:42:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 17:42:26< lobby> Partisani started game: "Partisanis Partie" (9197) with: Partisani, cajon. Settings: map: SXC_SpoOky_Forest_0.2.98 era: Ageless RPG Era XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 17:42:47< lobby> Gronomo started game: "1x1, 2 kings each, random, no newb" (9193) with: Gronomo, screwtop. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 17:43:39< lobby> orphen ended game: "yoyaku" (9096) at turn: 20 with reason: 'game over'. (socket: 13842) 20120326 17:43:53< lobby> KLASHINKOOV ended game: "KLASHINKOOV’s game" (9094) at turn: 29 with reason: 'game over'. (socket: 13890) 20120326 17:44:03< lobby> capricorn ended game: "capricorns Partie" (9055) at turn: 31 with reason: 'aborted'. (socket: 13887) 20120326 17:44:07< lobby> kamil ended game: "RANDOM ONLY - XP30% - Free for all !" (9176) at turn: 6 with reason: 'game over'. (socket: 13778) 20120326 17:44:49< lobby> 20120326 17:44:49 Statistics: number_of_games = 37 number_of_users = 135 lobby_users = 40 20120326 17:45:05< tuxlobby> 20120326 17:45:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 17:45:50< lobby> Clow ended game: "Clows Partie" (9195) at turn: 10 with reason: 'game over'. (socket: 14010) 20120326 17:46:04< lobby> JC-D started game: "RANDOM ONLY - XP30% - Free for all !" (9200) with: JC-D, juri, zirritualla, Tortueman. Settings: map: user_map era: era_default XP: 30 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 17:46:22< lobby> Tim ended game: "Game survival" (9129) at turn: 36 with reason: 'aborted'. (socket: 14011) 20120326 17:46:27< lobby> Clow started game: "Clows Partie" (9202) with: Clow. Settings: map: multiplayer_Hamlets era: Ageless Era XP: 30 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 17:46:52< lobby> icaros started game: "icaros’s game" (9198) with: icaros, Dhill, Um. Settings: map: ice era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 17:46:53< lobby> ksz ended game: "f" (9127) at turn: 49 with reason: 'game over'. (socket: 14002) 20120326 17:47:09< lobby> Ishimi started game: "nome de Ishimi" (9190) with: Ishimi, jogador, Miguis, Arthasss, Limon, Gorolanius. Settings: map: Colosseum_scenario era: Ageless RPG Era XP: 30 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 17:47:12< lobby> WhiteTiger started game: "Tim" (9203) with: WhiteTiger, Tim. Settings: map: multiplayer_2p_Dark_Forecast era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 17:47:24< dicplobby> 20120326 17:47:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 17:47:29< lobby> aori ended game: "Perseus’s game" (9124) at turn: 14 with reason: 'game over'. (socket: 13981) 20120326 17:48:27< lobby> Nordmann started game: "Nordmann vs KhiM Ladder" (9206) with: Nordmann, khiM. Settings: map: RMP_Classic era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 17:48:33< lobby> Nordmann advanced game: "Nordmann vs KhiM Ladder" (9206) with: Nordmann, khiM. Settings: map: RMP_Sullas_Ruins_12 era: XP: 70 GPV: fog: shroud: observers: shuffle: timer: 20120326 17:48:40< lobby> Sorkkimus started game: "Know the campaign - Diff: General + XP era" (9204) with: Sorkkimus, Perseus, hay206. Settings: map: World_Conquest_Start era: Dov_XP_Mod XP: 80 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 17:48:59< lobby> mengluo started game: "mengluo’s game" (9205) with: mengluo, kamil, aori, ksz, skarlatus. Settings: map: SXC_Figure_0.2.98 era: Ageless RPG Era XP: 130 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 17:49:04< lobby> R-I-P started game: "R-I-Ps Partie" (9208) with: R-I-P, 5in7. Settings: map: multiplayer_Cynsaun_Battlefield era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 17:49:14< lobby> aori ended game: "mengluo’s game" (9205) at turn: 1 with reason: 'aborted'. (socket: 13981) 20120326 17:49:44< lobby> Sir_Coffeebeans started game: "Sir_Coffeebeans’n peli" (9201) with: Sir_Coffeebeans, roope. Settings: map: multiplayer_Hamlets era: era_default XP: 40 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 17:49:49< lobby> 20120326 17:49:49 Statistics: number_of_games = 40 number_of_users = 140 lobby_users = 34 20120326 17:49:55< lobby> mengluo started game: "mengluo’s game" (9209) with: mengluo, skarlatus, ksz, aori, LuizBR. Settings: map: SXC_Figure_0.2.98 era: Ageless RPG Era XP: 130 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 17:50:04< lobby> aori ended game: "mengluo’s game" (9209) at turn: 1 with reason: 'aborted'. (socket: 13981) 20120326 17:50:05< tuxlobby> 20120326 17:50:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 17:50:55< lobby> azzoole ended game: "azzoole’s game" (9088) at turn: 36 with reason: 'game over'. (socket: 13903) 20120326 17:52:16< lobby> misterx100 started game: "misterx100’s game" (9210) with: misterx100, yep, Charles_Br, TheMAze, ksz, azzoole. Settings: map: multiplayer_6p_Team_Survival era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 17:52:24< dicplobby> 20120326 17:52:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 17:52:56< lobby> skarlatus started game: "nome de skarlatus" (9212) with: skarlatus, LuizBR, kamil, aori. Settings: map: Creep old alternate map version v0.2.11.1 era: Ageless RPG Era XP: 60 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 17:53:08< lobby> widowmaker80 ended game: "Ladder for windowmaker80" (9136) at turn: 12 with reason: 'game over'. (socket: 13445) 20120326 17:54:06< lobby> richard_wang started game: "richard_wang的游戏" (9211) with: richard_wang, orgo, Spiderlord, Paxe. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 17:54:42< lobby> TheMAze ended game: "misterx100’s game" (9210) at turn: 1 with reason: 'aborted'. (socket: 14125) 20120326 17:54:49< lobby> 20120326 17:54:49 Statistics: number_of_games = 40 number_of_users = 144 lobby_users = 35 20120326 17:55:05< tuxlobby> 20120326 17:55:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 17:55:11< lobby> Haugen1992 ended game: "Haugen1992’s game" (8329) at turn: 116 with reason: 'out of sync'. (socket: 12755) 20120326 17:55:39< lobby> Applethree ended game: "Applethree’s game" (9189) at turn: 11 with reason: 'aborted'. (socket: 13728) 20120326 17:56:55< lobby> xela started game: "xela’s game" (9216) with: xela. Settings: map: isars_blasphemy era: era_default XP: 60 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 17:57:24< dicplobby> 20120326 17:57:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 17:57:54< lobby> misterx100 started game: "misterx100’s game" (9215) with: misterx100, Charles_Br, azzoole, yep, danpe, Roger. Settings: map: multiplayer_6p_Team_Survival era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 17:58:16< lobby> Demon626 ended game: "michi323s Partie" (9182) at turn: 7 with reason: 'game over'. (socket: 14064) 20120326 17:58:23< lobby> Gronomo ended game: "1x1, 2 kings each, random, no newb" (9193) at turn: 6 with reason: 'aborted'. (socket: 14048) 20120326 17:58:33< lobby> Eldirian started game: "Eldirian’s game" (9217) with: Eldirian, isril, Radin, screwtop. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 17:58:36< lobby> xela ended game: "xela’s game" (9216) at turn: 3 with reason: 'game over'. (socket: 14132) 20120326 17:58:57< lobby> Qtan ended game: "Qtan のゲーム" (9184) at turn: 8 with reason: 'game over'. (socket: 14056) 20120326 17:59:10< lobby> xela started game: "xela’s game" (9220) with: xela. Settings: map: isars_blasphemy era: era_default XP: 60 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 17:59:33< lobby> janga ended game: "hraje Soni" (9191) at turn: 8 with reason: 'aborted'. (socket: 14088) 20120326 17:59:49< lobby> 20120326 17:59:49 Statistics: number_of_games = 39 number_of_users = 147 lobby_users = 39 20120326 17:59:56< lobby> pleiteseinistok started game: "pleiteseinistoks Partie" (9221) with: pleiteseinistok. Settings: map: multiplayer_Merkwuerdigliebe era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 18:00:05< tuxlobby> 20120326 18:00:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 18:01:11< lobby> Yaverot started game: "VVaiting thoste" (9219) with: Yaverot, Thoste. Settings: map: multiplayer_4p_Underworld era: era_heroes XP: 50 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 18:01:18< lobby> Clow ended game: "Clows Partie" (9202) at turn: 18 with reason: 'game over'. (socket: 14010) 20120326 18:01:18< lobby> Soni started game: "hraje Soni" (9222) with: Soni, janga, ksz, kelenz. Settings: map: 2vs2Survival era: Ageless Era XP: 50 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 18:01:31< lobby> mengluo started game: "Try 3" (9218) with: mengluo, Um, icaros, LuizBR1. Settings: map: SXC_CursedLand_0.2.98 era: Ageless RPG Era XP: 130 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 18:01:59< lobby> AVISTA ended game: "Gra użytkownika AVISTA" (9166) at turn: 18 with reason: 'aborted'. (socket: 14053) 20120326 18:01:59< lobby> Klesh started game: "Kleshs Partie" (9224) with: Klesh, kJudas. Settings: map: multiplayer_Fallenstar_Lake era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 18:02:06< lobby> Clow started game: "Clows Partie" (9226) with: Clow. Settings: map: multiplayer_8p_Morituri era: Ageless Era XP: 30 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 18:02:20< lobby> aori ended game: "nome de skarlatus" (9212) at turn: 5 with reason: 'aborted'. (socket: 13981) 20120326 18:02:25< dicplobby> 20120326 18:02:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 18:02:46< lobby> Hope started game: "Gra użytkownika Hope" (9228) with: Hope. Settings: map: 2v2_Peninsula_Survival era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 18:02:53< lobby> 2v2 anyone? 20120326 18:02:58< lobby> xela ended game: "xela’s game" (9220) at turn: 6 with reason: 'aborted'. (socket: 14132) 20120326 18:03:07< lobby> Hope ended game: "Gra użytkownika Hope" (9228) at turn: 1 with reason: 'aborted'. (socket: 14165) 20120326 18:04:45< lobby> swrnjtbs started game: "swrnjtbs’s game" (9232) with: swrnjtbs, rotny. Settings: map: multiplayer_Hamlets era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 18:04:45< lobby> Sakatukitukasa ended game: "ladder for yzr" (9186) at turn: 12 with reason: 'game over'. (socket: 13928) 20120326 18:04:55< lobby> 20120326 18:04:55 Statistics: number_of_games = 43 number_of_users = 144 lobby_users = 36 20120326 18:05:05< tuxlobby> 20120326 18:05:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 18:05:59< lobby> Hope started game: "Gra użytkownika Hope" (9234) with: Hope, Demon626. Settings: map: ice era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 18:06:13< lobby> Y U NO PLAY? 20120326 18:06:32< lobby> Enryomegl started game: "Battaglia di Enryomegl" (9236) with: Enryomegl, AceKing. Settings: map: ice era: Ageless Era XP: 80 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 18:07:24< dicplobby> 20120326 18:07:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 18:07:54< lobby> Karacole started game: "Karacole’s game" (9243) with: Karacole. Settings: map: multiplayer_Hamlets era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 18:08:11< lobby> nilsdeux started game: "Jeu de nilsdeux" (9240) with: nilsdeux, Ivan_D, Mastermind. Settings: map: Colosseum_scenario era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 18:08:12< lobby> skarlatus started game: "nome de skarlatus" (9229) with: skarlatus, kamil, zumbies, gf. Settings: map: Creep old alternate map version v0.2.11.1 era: Ageless RPG Era XP: 60 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 18:08:50< lobby> pleiteseinistok ended game: "pleiteseinistoks Partie" (9221) at turn: 11 with reason: 'game over'. (socket: 14153) 20120326 18:08:58< lobby> Gogoth started game: "Игра Gogoth" (9247) with: Gogoth. Settings: map: 3pSurvival era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 18:08:58< lobby> Partisani ended game: "Partisanis Partie" (9197) at turn: 21 with reason: 'aborted'. (socket: 14100) 20120326 18:09:16< lobby> pleiteseinistok started game: "pleiteseinistoks Partie" (9249) with: pleiteseinistok. Settings: map: multiplayer_Auction-X era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 18:09:55< lobby> 20120326 18:09:55 Statistics: number_of_games = 48 number_of_users = 156 lobby_users = 39 20120326 18:10:05< tuxlobby> 20120326 18:10:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 18:10:41< lobby> Partisani started game: "Partisanis Partie" (9250) with: Partisani, cajon. Settings: map: SXC_SpoOky_Forest_0.2.98 era: Ageless RPG Era XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 18:10:41< lobby> sega started game: "Игра sega" (9252) with: sega, zorych. Settings: map: multiplayer_Arcanclave_Citadel era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 18:11:21< lobby> Kungsoren started game: "Kungsorens spel" (9255) with: Kungsoren. Settings: map: multiplayer_Arcanclave_Citadel era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 18:11:23< lobby> warfall started game: "warfall’s game" (9254) with: warfall. Settings: map: SXRPG CastleOfCantar era: SX_RPG_Era XP: 130 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 18:11:55< lobby> KeijoK started game: "KeijoK’s survival" (9257) with: KeijoK. Settings: map: 2v2_Peninsula_Survival era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 18:12:13< lobby> Rusty_Polok2 started game: "SXC" (9235) with: Rusty_Polok2, aori, Sigmar, kelenz. Settings: map: SXC_BraveHeart_0.2.98 era: Ageless RPG Era XP: 130 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 18:12:24< dicplobby> 20120326 18:12:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 18:12:48< lobby> chocoboner started game: "chocoboner’s 2v1v2" (9241) with: chocoboner, Slavik. Settings: map: user_map era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 18:13:39< lobby> zirritualla ended game: "RANDOM ONLY - XP30% - Free for all !" (9200) at turn: 15 with reason: 'game over'. (socket: 14052) 20120326 18:14:55< lobby> 20120326 18:14:55 Statistics: number_of_games = 52 number_of_users = 155 lobby_users = 31 20120326 18:15:06< tuxlobby> 20120326 18:15:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 18:15:27< lobby> Wicia777 started game: "Wicia777’s game" (9238) with: Wicia777, Smozes, zirritualla, Mike. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 18:15:49< lobby> Sir_Coffeebeans ended game: "Sir_Coffeebeans’n peli" (9201) at turn: 7 with reason: 'aborted'. (socket: 14097) 20120326 18:15:59< lobby> Clow ended game: "Clows Partie" (9226) at turn: 10 with reason: 'aborted'. (socket: 14010) 20120326 18:16:21< lobby> vipyojo ended game: "vipyojo のゲーム" (9024) at turn: 20 with reason: 'aborted' and disconnected. (socket: 13829) 20120326 18:16:31< lobby> warfall ended game: "warfall’s game" (9254) at turn: 1 with reason: 'aborted'. (socket: 14185) 20120326 18:17:20< lobby> kamil ended game: "nome de skarlatus" (9229) at turn: 6 with reason: 'aborted'. (socket: 13778) 20120326 18:17:20< lobby> JC-D started game: "RANDOM ONLY - XP30% - FRee for all !" (9259) with: JC-D, Tortueman, newkoas, mortalenemy. Settings: map: user_map era: era_default XP: 30 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 18:17:24< dicplobby> 20120326 18:17:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 18:18:10< lobby> Demon626 ended game: "Gra użytkownika Hope" (9234) at turn: 7 with reason: 'aborted'. (socket: 14064) 20120326 18:18:38< lobby> warfall started game: "warfall’s game" (9262) with: warfall. Settings: map: SXRPG CastleOfCantar era: SX_RPG_Era XP: 130 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 18:19:05< lobby> fail started game: "La partida de fail" (9263) with: fail. Settings: map: 2vs2Survival era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 18:19:18< lobby> Anderson started game: "Civ Builder Wars" (9261) with: Anderson, skarlatus, Darkforce6246. Settings: map: multiplayer_Random_Map era: GC_era XP: 40 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 18:19:29< lobby> warfall ended game: "warfall’s game" (9262) at turn: 1 with reason: 'aborted'. (socket: 14207) 20120326 18:19:55< lobby> 20120326 18:19:55 Statistics: number_of_games = 51 number_of_users = 158 lobby_users = 30 20120326 18:20:06< tuxlobby> 20120326 18:20:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 18:20:27< lobby> warfall started game: "warfall’s game" (9266) with: warfall. Settings: map: SXRPG CastleOfCantar era: SX_RPG_Era XP: 130 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 18:20:41< lobby> Hope started game: "Survival 2/3 players" (9264) with: Hope, gf. Settings: map: ice era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 18:21:03< lobby> gf ended game: "Survival 2/3 players" (9264) at turn: 1 with reason: 'aborted'. (socket: 14180) 20120326 18:21:40< lobby> KeijoK ended game: "KeijoK’s survival" (9257) at turn: 8 with reason: 'aborted'. (socket: 14192) 20120326 18:21:43< lobby> lipk started game: "lipk's game - feel free to join" (9269) with: lipk, JustynatheWiewiura. Settings: map: multiplayer_Den_of_Onis era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 18:22:11< lobby> honululu started game: "Random Average Time" (9265) with: honululu, kamil, aori, Ollowain, kelenz, Slippy. Settings: map: Colosseum_scenario era: Ageless RPG Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 18:22:24< dicplobby> 20120326 18:22:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 18:22:44< lobby> pleiteseinistok ended game: "pleiteseinistoks Partie" (9249) at turn: 23 with reason: 'game over'. (socket: 14153) 20120326 18:23:17< lobby> Hope started game: "Survival 3 players" (9267) with: Hope, Sigmar. Settings: map: ice era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 18:23:19< lobby> Gogoth ended game: "Игра Gogoth" (9247) at turn: 21 with reason: 'game over'. (socket: 14161) 20120326 18:23:54< lobby> Clow started game: "Clows Partie" (9260) with: Clow. Settings: map: multiplayer_Merkwuerdigliebe era: Ageless Heroes XP: 30 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 18:23:58< lobby> zen ended game: "WC NIGHTMARE join if u have played this before" (9196) at turn: 8 with reason: 'aborted'. (socket: 13973) 20120326 18:24:08< lobby> Clow ended game: "Clows Partie" (9260) at turn: 1 with reason: 'aborted'. (socket: 14010) 20120326 18:24:17< lobby> warfall ended game: "warfall’s game" (9266) at turn: 1 with reason: 'aborted'. (socket: 14207) 20120326 18:24:47< lobby> _NiCo_ started game: "WC NIGHTMARE join if u have played this before" (9271) with: _NiCo_, Miguel, Pumdumplumbum. Settings: map: World_Conquest_Start era: era_default XP: 80 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 18:24:48< lobby> warfall started game: "warfall’s game" (9273) with: warfall. Settings: map: SXRPG CastleOfCantar era: SX_RPG_Era XP: 130 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 18:24:49< lobby> jogador ended game: "nome de Ishimi" (9190) at turn: 10 with reason: 'aborted'. (socket: 14037) 20120326 18:24:55< lobby> 20120326 18:24:55 Statistics: number_of_games = 51 number_of_users = 157 lobby_users = 33 20120326 18:25:05< tuxlobby> 20120326 18:25:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 18:25:23< lobby> chocoboner ended game: "chocoboner’s 2v1v2" (9241) at turn: 4 with reason: 'aborted'. (socket: 14158) 20120326 18:25:36< lobby> 5in7 ended game: "R-I-Ps Partie" (9208) at turn: 10 with reason: 'game over'. (socket: 14106) 20120326 18:25:40< lobby> Killlr started game: "Killlrs Partie" (9274) with: Killlr, Tschjo, zen, Atasco. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 18:26:12< lobby> Clow started game: "Clows Partie" (9272) with: Clow. Settings: map: multiplayer_Merkwuerdigliebe era: Ageless Heroes XP: 30 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 18:27:06< lobby> Clow ended game: "Clows Partie" (9272) at turn: 1 with reason: 'aborted'. (socket: 14010) 20120326 18:27:25< dicplobby> 20120326 18:27:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 18:27:57< lobby> Clow started game: "Clows Partie" (9279) with: Clow. Settings: map: multiplayer_Merkwuerdigliebe era: Ageless Era XP: 30 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 18:28:30< lobby> Rusty_Polok2 ended game: "SXC" (9235) at turn: 1 with reason: 'aborted' and disconnected. (socket: 14157) 20120326 18:29:22< lobby> swrnjtbs ended game: "swrnjtbs’s game" (9232) at turn: 9 with reason: 'aborted'. (socket: 14148) 20120326 18:29:42< lobby> Ishimi started game: "nome de Ishimi" (9276) with: Ishimi, Arthasss, Limon, jogador, Miguis. Settings: map: multiplayer_Auction-X era: Ageless RPG Era XP: 30 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 18:29:55< lobby> 20120326 18:29:55 Statistics: number_of_games = 48 number_of_users = 157 lobby_users = 41 20120326 18:29:55< lobby> WhiteTiger ended game: "Tim" (9203) at turn: 31 with reason: 'aborted'. (socket: 14004) 20120326 18:30:05< tuxlobby> 20120326 18:30:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 18:30:28< lobby> jogador ended game: "nome de Ishimi" (9276) at turn: 1 with reason: 'aborted'. (socket: 14230) 20120326 18:31:34< lobby> Kungsoren ended game: "Kungsorens spel" (9255) at turn: 16 with reason: 'game over' and disconnected. (socket: 14191) 20120326 18:32:06< lobby> osap started game: "Jeu de osap" (9289) with: osap. Settings: map: 3pSurvival era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 18:32:24< lobby> osap ended game: "Jeu de osap" (9289) at turn: 1 with reason: 'aborted'. (socket: 14241) 20120326 18:32:24< dicplobby> 20120326 18:32:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 18:32:29< lobby> Coleatus ended game: "Coleatuss Partie" (9164) at turn: 21 with reason: 'game over'. (socket: 13997) 20120326 18:32:31< lobby> Gronomo started game: "1x1, 2 kings each, random, no newb" (9288) with: Gronomo, Calandryl. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 18:32:39< lobby> osap started game: "Jeu de osap" (9290) with: osap. Settings: map: 3pSurvival era: Dov_XP_Mod XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 18:32:40< lobby> kelenz ended game: "Random Average Time" (9265) at turn: 5 with reason: 'aborted'. (socket: 13915) 20120326 18:32:45< lobby> Durr started game: "Durr’s game" (9287) with: Durr, WarDuck. Settings: map: multiplayer_Paths_of_Daggers era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 18:32:53< lobby> osap ended game: "Jeu de osap" (9290) at turn: 1 with reason: 'aborted'. (socket: 14241) 20120326 18:33:12< lobby> TheMAze started game: "for EXPERIENCED " (9282) with: TheMAze, Charles_Br, kriller, Slavik. Settings: map: 2vs2Survival era: Dov_Drops_Mod XP: 50 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 18:33:17< lobby> Ishimi started game: "nome de Ishimi" (9284) with: Ishimi, Limon, Miguis, jogador, Slippy. Settings: map: multiplayer_Auction-X era: era_default XP: 30 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 18:34:13< lobby> raleeha started game: "raleehas Partie" (9293) with: raleeha, Slippy. Settings: map: multiplayer_4p_Lucky_Sevens_V4 era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 18:34:39< lobby> jogador ended game: "nome de Ishimi" (9284) at turn: 1 with reason: 'aborted'. (socket: 14230) 20120326 18:34:50< lobby> Vercingetorige started game: "NIGHTMARE WC, only players who know the map" (9285) with: Vercingetorige, aljuma, osap. Settings: map: World_Conquest_Start era: era_default XP: 80 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 18:34:58< lobby> 20120326 18:34:58 Statistics: number_of_games = 50 number_of_users = 163 lobby_users = 43 20120326 18:35:05< tuxlobby> 20120326 18:35:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 18:35:11< lobby> Um ended game: "Try 3" (9218) at turn: 12 with reason: 'aborted'. (socket: 14035) 20120326 18:35:28< lobby> lipk ended game: "lipk's game - feel free to join" (9269) at turn: 7 with reason: 'aborted'. (socket: 14212) 20120326 18:36:33< lobby> lipk started game: "lipk's game - feel free to join" (9302) with: lipk, clarthronus. Settings: map: multiplayer_Hornshark_Island era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 18:36:38< lobby> Ishimi started game: "nome de Ishimi" (9294) with: Ishimi, Limon, jogador, Arthasss, Orgasm. Settings: map: multiplayer_Auction-X era: era_default XP: 30 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 18:36:44< lobby> TheMAze started game: "TheMAze’s game" (9301) with: TheMAze, kriller, Prydze, Cornelius. Settings: map: 2vs2Survival era: Dov_Drops_Mod XP: 50 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 18:36:46< lobby> WhiteTiger started game: "Game survival" (9296) with: WhiteTiger, UglyGrunt. Settings: map: multiplayer_2p_Dark_Forecast era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 18:37:24< dicplobby> 20120326 18:37:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 18:38:00< lobby> zorych ended game: "Игра sega" (9252) at turn: 9 with reason: 'aborted'. (socket: 14181) 20120326 18:38:05< lobby> Blainn ended game: "AxtImWaldes Partie" (9126) at turn: 24 with reason: 'game over'. (socket: 13994) 20120326 18:38:25< lobby> Sorkkimus advanced game: "Know the campaign - Diff: General + XP era" (9204) with: Sorkkimus, Perseus, hay206. Settings: map: TL_WC_NM_Island2 era: XP: 80 GPV: fog: shroud: observers: shuffle: timer: 20120326 18:38:26< lobby> mengluo started game: "mengluo’s game" (9304) with: mengluo, Um, LuizBR, icaros, Slavik. Settings: map: SXC_Light_Cave_0.2.98 era: Ageless RPG Era XP: 130 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 18:38:44< lobby> 2v2 20120326 18:38:53< lobby> sega started game: "Игра sega" (9306) with: sega, zorych. Settings: map: multiplayer_Den_of_Onis era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 18:39:16< lobby> Gretik started game: "Gretik’s game" (9303) with: Gretik, NightAblaze, Sneaky. Settings: map: TGQ_Scenario1_Homeland era: era_default XP: 100 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 18:39:47< lobby> Karacole ended game: "Karacole’s game" (9243) at turn: 22 with reason: 'game over'. (socket: 14178) 20120326 18:39:58< lobby> 20120326 18:39:58 Statistics: number_of_games = 53 number_of_users = 165 lobby_users = 37 20120326 18:40:05< tuxlobby> 20120326 18:40:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 18:41:03< lobby> Orgasm started game: "Orgasm’s game" (9305) with: Orgasm, zirritualla, torben, lolek3. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 18:41:10< lobby> Karacole started game: "Karacole’s game" (9310) with: Karacole. Settings: map: multiplayer_Fallenstar_Lake era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 18:41:29< lobby> raleeha ended game: "raleehas Partie" (9293) at turn: 5 with reason: 'aborted'. (socket: 14252) 20120326 18:42:10< lobby> WhiteTiger ended game: "Game survival" (9296) at turn: 7 with reason: 'aborted'. (socket: 14004) 20120326 18:42:11< lobby> Zontek started game: "Gra użytkownika Zontek" (9300) with: Zontek, Wilku. Settings: map: multiplayer_Random_Map_Marsh era: era_eeaw_1.5.2 XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 18:42:24< dicplobby> 20120326 18:42:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 18:43:42< lobby> isril ended game: "Eldirian’s game" (9217) at turn: 10 with reason: 'game over'. (socket: 14137) 20120326 18:43:51< lobby> Partisani ended game: "Partisanis Partie" (9250) at turn: 32 with reason: 'aborted'. (socket: 14100) 20120326 18:44:20< lobby> Demon626 started game: "Demon626s Partie" (9312) with: Demon626, michi323. Settings: map: multiplayer_3p_Morituri era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 18:44:26< lobby> WhiteTiger started game: "Game survival" (9311) with: WhiteTiger, screwtop. Settings: map: multiplayer_2p_Dark_Forecast era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 18:44:44< lobby> kkk ended game: "Игра Tovarish_Tufca" (9167) at turn: 26 with reason: 'aborted'. (socket: 14061) 20120326 18:44:45< lobby> chocoboner started game: "chocoboner’s 2v1v2" (9308) with: chocoboner, Mywish, Narcissus-Pontius, Rusty_Polok2. Settings: map: user_map era: era_heroes XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 18:44:58< lobby> 20120326 18:44:58 Statistics: number_of_games = 54 number_of_users = 162 lobby_users = 33 20120326 18:45:05< tuxlobby> 20120326 18:45:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 18:45:22< lobby> Clow ended game: "Clows Partie" (9279) at turn: 14 with reason: 'aborted'. (socket: 14010) 20120326 18:46:28< lobby> Clow started game: "Clows Partie" (9319) with: Clow. Settings: map: multiplayer_Auction-X era: Ageless Heroes XP: 30 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 18:46:41< lobby> fail ended game: "La partida de fail" (9263) at turn: 11 with reason: 'aborted'. (socket: 14203) 20120326 18:47:24< dicplobby> 20120326 18:47:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 18:47:40< lobby> Miguis started game: "nome de Miguis" (9320) with: Miguis. Settings: map: Colosseum_scenario era: Ageless Era XP: 30 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 18:47:51< lobby> warfall ended game: "warfall’s game" (9273) at turn: 16 with reason: 'aborted'. (socket: 14207) 20120326 18:47:59< lobby> chocoboner ended game: "chocoboner’s 2v1v2" (9308) at turn: 1 with reason: 'aborted'. (socket: 14258) 20120326 18:48:17< lobby> Judge-dead started game: "Jeu de Judge-dead" (9324) with: Judge-dead. Settings: map: TGQ_Scenario1_Homeland era: era_default XP: 50 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 18:48:18< lobby> warfall started game: "warfall’s game" (9323) with: warfall. Settings: map: SXRPG CastleOfCantar era: SX_RPG_Era XP: GPV: fog: shroud: observers: no shuffle: no timer: 20120326 18:48:19< lobby> warfall ended game: "warfall’s game" (9323) at turn: 16 with reason: 'aborted'. (socket: 14207) 20120326 18:48:45< lobby> warfall started game: "warfall’s game" (9327) with: warfall. Settings: map: SXRPG CastleOfCantar era: SX_RPG_Era XP: GPV: fog: shroud: observers: no shuffle: no timer: 20120326 18:49:01< lobby> Denhonator ended game: "Daemon’s game" (9172) at turn: 19 with reason: 'game over'. (socket: 14060) 20120326 18:49:24< lobby> Hola a todos 20120326 18:49:37< lobby> chupa me penga 20120326 18:49:58< lobby> 20120326 18:49:58 Statistics: number_of_games = 55 number_of_users = 162 lobby_users = 34 20120326 18:50:05< tuxlobby> 20120326 18:50:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 18:50:15< lobby> CRAZYpotato started game: "DEATHMATCH" (9328) with: CRAZYpotato, Mywish, yep, juri. Settings: map: mini_4p_new_dm era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 18:50:46< lobby> Miguis ended game: "nome de Miguis" (9320) at turn: 4 with reason: 'aborted'. (socket: 14102) 20120326 18:51:11< lobby> Darkforce6246 ended game: "Civ Builder Wars" (9261) at turn: 8 with reason: 'aborted'. (socket: 14206) 20120326 18:51:15< lobby> Sane started game: "Sane’n peli" (9315) with: Sane, Nestor, Nyme. Settings: map: user_map era: era_heroes XP: 100 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 18:51:32< lobby> Charles_Br ended game: "for EXPERIENCED " (9282) at turn: 1 with reason: 'aborted'. (socket: 14050) 20120326 18:51:50< lobby> Judge-dead ended game: "Jeu de Judge-dead" (9324) at turn: 2 with reason: 'aborted'. (socket: 14299) 20120326 18:52:03< lobby> Mmatthew started game: "Mmatthew’s game" (9318) with: Mmatthew. Settings: map: multiplayer_8p_Morituri era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 18:52:25< dicplobby> 20120326 18:52:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 18:52:45< lobby> Judge-dead started game: "Jeu de Judge-dead" (9336) with: Judge-dead. Settings: map: SXRPG TheEvilDead era: era_default XP: 50 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 18:52:52< lobby> Rusty_Polok started game: "SXC" (9326) with: Rusty_Polok, PEPE, kelenz, Charles_Br. Settings: map: SXC_BraveHeart_0.2.98 era: Ageless RPG Era XP: 130 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 18:52:53< lobby> skarlatus started game: "nome de skarlatus" (9330) with: skarlatus. Settings: map: user_map era: (A New Land Classic)A New Land:Standard XP: 40 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 18:52:59< lobby> Judge-dead ended game: "Jeu de Judge-dead" (9336) at turn: 1 with reason: 'game over'. (socket: 14299) 20120326 18:53:05< lobby> MuDuck started game: "MuDuck" (9331) with: MuDuck, 4ubaits, triger. Settings: map: TGQ_Scenario1_Homeland era: TGQ_era XP: 100 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 18:53:41< lobby> jugador ended game: "La partida de jugador" (9194) at turn: 14 with reason: 'aborted'. (socket: 14093) 20120326 18:54:02< lobby> chocoboner started game: "chocoboner’s 2v1v2" (9335) with: chocoboner, Darkforce6246, DrunkenStyle, nikahn. Settings: map: user_map era: era_heroes XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 18:54:26< lobby> PEDRODAKING started game: "PEDRODAKING-ova hra" (9338) with: PEDRODAKING. Settings: map: multiplayer_The_Wilderlands era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 18:54:37< lobby> PEDRODAKING ended game: "PEDRODAKING-ova hra" (9338) at turn: 1 with reason: 'aborted'. (socket: 14313) 20120326 18:54:38< lobby> Velociraptor started game: "La partida de Velociraptor" (9337) with: Velociraptor. Settings: map: isars_blasphemy era: Ageless Era XP: 50 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 18:54:51< lobby> Rob started game: "Rob’s game" (9333) with: Rob, 0_o, mortalenemy, pusukala. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 18:54:51< lobby> lipk ended game: "lipk's game - feel free to join" (9302) at turn: 10 with reason: 'game over'. (socket: 14212) 20120326 18:54:58< lobby> 20120326 18:54:58 Statistics: number_of_games = 55 number_of_users = 169 lobby_users = 31 20120326 18:55:05< tuxlobby> 20120326 18:55:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 18:55:31< lobby> Belton started game: "Jeu de Belton" (9334) with: Belton, Glandouillette. Settings: map: multiplayer_Castle_Hopping_Isle era: Ageless Era XP: 30 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 18:56:01< lobby> china started game: "china’s game" (9339) with: china, kkk, mysticknight, Gairilius. Settings: map: 2vs2Survival era: era_default XP: 50 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 18:56:23< lobby> the5th started game: "the5ths (SXRPGADDON needed)" (9321) with: the5th, aori, Epicuro, Narcissus-Pontius, PEPE. Settings: map: SXRPG WizardOfWarII era: Ageless RPG Era XP: 130 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 18:57:24< dicplobby> 20120326 18:57:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 18:57:41< lobby> Clebermiguel started game: "nome de Clebermiguel" (9342) with: Clebermiguel, soyvirgen. Settings: map: multiplayer_Island_of_the_Horatii era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 18:58:01< lobby> Kpp started game: "Ladder (registration required)" (9332) with: Kpp, DwarvishRhapsody. Settings: map: RBY Classic 9 era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 18:58:19< lobby> Kpp advanced game: "Ladder (registration required)" (9332) with: Kpp, DwarvishRhapsody. Settings: map: RBY Sullas Ruins 12 era: XP: 70 GPV: fog: shroud: observers: shuffle: timer: 20120326 18:59:11< lobby> MaTi ended game: "Gra użytkownika MSKPL" (9155) at turn: 20 with reason: 'game over'. (socket: 14044) 20120326 18:59:39< lobby> skarlatus ended game: "nome de skarlatus" (9330) at turn: 10 with reason: 'aborted'. (socket: 14032) 20120326 18:59:53< lobby> Tortueman ended game: "RANDOM ONLY - XP30% - FRee for all !" (9259) at turn: 19 with reason: 'game over'. (socket: 14042) 20120326 18:59:58< lobby> 20120326 18:59:58 Statistics: number_of_games = 54 number_of_users = 163 lobby_users = 28 20120326 19:00:05< tuxlobby> 20120326 19:00:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 19:00:12< lobby> Dankovski started game: "Игра Dankovski" (9344) with: Dankovski, xivarmy. Settings: map: multiplayer_Sablestone_Delta era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 19:00:38< lobby> zorych ended game: "Игра sega" (9306) at turn: 13 with reason: 'game over'. (socket: 14181) 20120326 19:00:53< lobby> skarlatus started game: "nome de skarlatus" (9345) with: skarlatus. Settings: map: user_map era: (A New Land Classic)A New Land:Standard XP: 40 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 19:01:06< lobby> Wilku 20120326 19:01:07< lobby> sega started game: "Игра sega" (9346) with: sega, zorych. Settings: map: multiplayer_Den_of_Onis era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 19:01:27< lobby> Smozes ended game: "Wicia777’s game" (9238) at turn: 11 with reason: 'aborted'. (socket: 14187) 20120326 19:02:03< lobby> universe ended game: "Jeu de universe" (9037) at turn: 57 with reason: 'game over'. (socket: 13763) 20120326 19:02:07< lobby> Velociraptor ended game: "La partida de Velociraptor" (9337) at turn: 7 with reason: 'aborted'. (socket: 14314) 20120326 19:02:24< dicplobby> 20120326 19:02:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 19:02:45< lobby> Clow ended game: "Clows Partie" (9319) at turn: 24 with reason: 'aborted'. (socket: 14010) 20120326 19:02:50< lobby> Clebermiguel ended game: "nome de Clebermiguel" (9342) at turn: 1 with reason: 'aborted'. (socket: 14318) 20120326 19:03:27< lobby> Velociraptor started game: "La partida de Velociraptor" (9350) with: Velociraptor. Settings: map: isars_blasphemy era: Ageless Era XP: 50 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 19:03:34< lobby> Ikerpeta ended game: "La partida de Ikerpeta" (9187) at turn: 6 with reason: 'aborted'. (socket: 14058) 20120326 19:03:34< lobby> Wicia777 started game: "Wicia777’s for Smo and two any others" (9348) with: Wicia777, zirritualla, Smozes, Panfil-Ugly. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 19:04:22< lobby> Conscience started game: "For Iker" (9352) with: Conscience, Ikerpeta. Settings: map: Conquest-Surdmark(teleports,long distances) era: Ageless RPG Era XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 19:04:30< lobby> Grond started game: "Grond’s game" (9343) with: Grond. Settings: map: Colosseum_scenario era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 19:05:03< lobby> 20120326 19:05:03 Statistics: number_of_games = 55 number_of_users = 164 lobby_users = 29 20120326 19:05:05< tuxlobby> 20120326 19:05:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 19:05:13< lobby> Mike started game: "Mike’s game" (9349) with: Mike, soyvirgen, Wepawetmose, Hakun, evea, Ivan_D. Settings: map: Creep War New Map v0.2.11.1 era: Creep_Era_v0.2.11.1 XP: 60 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 19:05:15< lobby> Roger ended game: "misterx100’s game" (9215) at turn: 11 with reason: 'aborted'. (socket: 13974) 20120326 19:05:47< lobby> Clow started game: "Clows Partie" (9351) with: Clow. Settings: map: multiplayer_Auction-X era: Ageless Heroes XP: 30 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 19:05:53< tuxlobby> vlado has logged on. (socket: 25238) 20120326 19:05:59< tuxlobby> vlado has logged off. (socket: 25238) 20120326 19:06:05< lobby> nilsdeux ended game: "Jeu de nilsdeux" (9240) at turn: 35 with reason: 'aborted'. (socket: 14172) 20120326 19:06:35< lobby> anyone got ageless era 20120326 19:06:48< lobby> Judge-dead started game: "Jeu de Judge-dead" (9355) with: Judge-dead. Settings: map: SXRPG TheEvilDead era: era_default XP: 50 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 19:06:50< dicplobby> vlado has logged on. (socket: 69) 20120326 19:06:53< lobby> ladder anyone? 20120326 19:07:09< lobby> warfall ended game: "warfall’s game" (9327) at turn: 28 with reason: 'aborted'. (socket: 14207) 20120326 19:07:10< lobby> Judge-dead ended game: "Jeu de Judge-dead" (9355) at turn: 1 with reason: 'game over'. (socket: 14299) 20120326 19:07:25< dicplobby> 20120326 19:07:24 Statistics: number_of_games = 0 number_of_users = 1 lobby_users = 1 20120326 19:07:37< lobby> Sigmar ended game: "Survival 3 players" (9267) at turn: 14 with reason: 'aborted'. (socket: 14186) 20120326 19:07:39< lobby> warfall started game: "warfall’s game" (9356) with: warfall. Settings: map: SXRPG CastleOfCantar era: SX_RPG_Era XP: GPV: fog: shroud: observers: no shuffle: no timer: 20120326 19:07:53< lobby> fefelix started game: "fefelixs Partie" (9353) with: fefelix, Zenzsei. Settings: map: multiplayer_2p_Dark_Forecast era: era_default XP: 100 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 19:08:01< lobby> Wilku ended game: "Gra użytkownika Zontek" (9300) at turn: 7 with reason: 'aborted' and disconnected. (socket: 14275) 20120326 19:08:44< lobby> JC-D started game: "RANDOM ONLY - XP30% - Free for all !" (9347) with: JC-D, fensy, Zontek, Predator. Settings: map: user_map era: era_default XP: 30 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 19:09:09< lobby> zen ended game: "Killlrs Partie" (9274) at turn: 11 with reason: 'aborted'. (socket: 13973) 20120326 19:09:16< lobby> warfall ended game: "warfall’s game" (9356) at turn: 28 with reason: 'aborted'. (socket: 14207) 20120326 19:09:36< lobby> warfall started game: "warfall’s game" (9358) with: warfall. Settings: map: SXRPG CastleOfCantar era: SX_RPG_Era XP: GPV: fog: shroud: observers: no shuffle: no timer: 20120326 19:10:03< lobby> 20120326 19:10:03 Statistics: number_of_games = 52 number_of_users = 161 lobby_users = 26 20120326 19:10:05< tuxlobby> 20120326 19:10:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 19:10:31< lobby> Grond ended game: "Grond’s game" (9343) at turn: 2 with reason: 'aborted'. (socket: 14329) 20120326 19:10:55< lobby> Wicia777 ended game: "Wicia777’s for Smo and two any others" (9348) at turn: 3 with reason: 'aborted'. (socket: 14146) 20120326 19:10:58< lobby> me 20120326 19:11:33< lobby> Clow ended game: "Clows Partie" (9351) at turn: 6 with reason: 'aborted'. (socket: 14010) 20120326 19:11:51< lobby> Ikerpeta ended game: "For Iker" (9352) at turn: 12 with reason: 'aborted'. (socket: 14058) 20120326 19:12:10< lobby> Conscience started game: "Jeu de Conscience" (9361) with: Conscience, Ikerpeta. Settings: map: Conquest-Surdmark(teleports,long distances) era: Ageless RPG Era XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 19:12:15< lobby> Clow started game: "Clows Partie" (9360) with: Clow. Settings: map: multiplayer_Cynsaun_Battlefield era: Ageless Heroes XP: 30 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 19:12:24< dicplobby> 20120326 19:12:24 Statistics: number_of_games = 1 number_of_users = 1 lobby_users = 0 20120326 19:12:37< dicplobby> vlado has logged off. (socket: 69) 20120326 19:12:40< lobby> warfall ended game: "warfall’s game" (9358) at turn: 29 with reason: 'aborted'. (socket: 14207) 20120326 19:12:41< lobby> Clow ended game: "Clows Partie" (9360) at turn: 1 with reason: 'aborted'. (socket: 14010) 20120326 19:12:59< lobby> warfall started game: "warfall’s game" (9362) with: warfall. Settings: map: SXRPG CastleOfCantar era: SX_RPG_Era XP: GPV: fog: shroud: observers: no shuffle: no timer: 20120326 19:14:01< lobby> warfall ended game: "warfall’s game" (9362) at turn: 30 with reason: 'aborted'. (socket: 14207) 20120326 19:14:03< lobby> khiM ended game: "Nordmann vs KhiM Ladder" (9206) at turn: 17 with reason: 'game over'. (socket: 13910) 20120326 19:14:31< lobby> warfall started game: "warfall’s game" (9365) with: warfall. Settings: map: SXRPG CastleOfCantar era: SX_RPG_Era XP: GPV: fog: shroud: observers: no shuffle: no timer: 20120326 19:14:59< lobby> Alfeno started game: "Battaglia di Alfeno" (9357) with: Alfeno, Therden, zirritualla, Camero. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 19:15:03< lobby> 20120326 19:15:03 Statistics: number_of_games = 50 number_of_users = 163 lobby_users = 34 20120326 19:15:05< tuxlobby> 20120326 19:15:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 19:16:32< lobby> skarlatus ended game: "nome de skarlatus" (9345) at turn: 22 with reason: 'aborted'. (socket: 14032) 20120326 19:17:24< dicplobby> 20120326 19:17:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 19:18:02< lobby> Schattenklau ended game: "mtw169s Partie" (9185) at turn: 23 with reason: 'aborted'. (socket: 14077) 20120326 19:18:20< lobby> michi323 ended game: "Demon626s Partie" (9312) at turn: 16 with reason: 'game over'. (socket: 14066) 20120326 19:18:33< lobby> Clow started game: "Clows Partie" (9364) with: Clow. Settings: map: multiplayer_Crusaders_Field era: Ageless Heroes XP: 30 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 19:19:30< lobby> Demon626 started game: "Demon626s Partie" (9369) with: Demon626, michi323. Settings: map: multiplayer_Loris_River era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 19:19:48< lobby> bibbo ended game: "Battaglia di bibbo" (9131) at turn: 16 with reason: 'aborted'. (socket: 13970) 20120326 19:20:05< tuxlobby> 20120326 19:20:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 19:20:06< lobby> 20120326 19:20:06 Statistics: number_of_games = 50 number_of_users = 162 lobby_users = 43 20120326 19:20:47< lobby> Judge-dead started game: "Jeu de Judge-dead" (9373) with: Judge-dead. Settings: map: 00_settings era: era_default XP: 50 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 19:21:10< lobby> Judge-dead advanced game: "Jeu de Judge-dead" (9373) with: Judge-dead. Settings: map: 01_world era: XP: GPV: fog: shroud: observers: shuffle: timer: 20120326 19:21:24< lobby> jesli zalozysz 20120326 19:21:34< lobby> njlepiej rpg 20120326 19:21:46< lobby> moonchild started game: "GL & HF" (9372) with: moonchild, Oli, ShadowVeil, vector. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 19:22:02< lobby> Wicia777 started game: "Wicia777’s game" (9359) with: Wicia777, Smozes, Darkforce6246. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 19:22:24< dicplobby> 20120326 19:22:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 19:22:41< lobby> Judge-dead advanced game: "Jeu de Judge-dead" (9373) with: Judge-dead. Settings: map: 02_battle era: XP: GPV: fog: shroud: observers: shuffle: timer: 20120326 19:22:54< lobby> renegade13 started game: "only players who know this map/era " (9370) with: renegade13, skarlatus, aerrow, NanRage. Settings: map: (A New Land Classic)The Great Wall era: (A New Land Classic)A New Land:Standard XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 19:23:21< lobby> WarDuck ended game: "Durr’s game" (9287) at turn: 19 with reason: 'game over'. (socket: 14243) 20120326 19:23:39< lobby> Karacole ended game: "Karacole’s game" (9310) at turn: 30 with reason: 'game over'. (socket: 14178) 20120326 19:25:05< tuxlobby> 20120326 19:25:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 19:25:06< lobby> 20120326 19:25:06 Statistics: number_of_games = 53 number_of_users = 171 lobby_users = 39 20120326 19:25:42< lobby> aori ended game: "the5ths (SXRPGADDON needed)" (9321) at turn: 7 with reason: 'aborted'. (socket: 13981) 20120326 19:25:45< lobby> Durr started game: "Durr’s game" (9377) with: Durr, WarDuck. Settings: map: multiplayer_Blue_Water_Province era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 19:25:50< lobby> WebbSeven started game: "WebbSeven's game" (9380) with: WebbSeven. Settings: map: user_map era: (A New Land Classic)A New Land:Expanded.0 XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 19:26:09< lobby> juri ended game: "DEATHMATCH" (9328) at turn: 45 with reason: 'game over'. (socket: 14225) 20120326 19:26:35< lobby> warfall ended game: "warfall’s game" (9365) at turn: 37 with reason: 'aborted'. (socket: 14207) 20120326 19:26:41< lobby> AceKing ended game: "Battaglia di Enryomegl" (9236) at turn: 26 with reason: 'aborted'. (socket: 14166) 20120326 19:26:59< lobby> warfall started game: "warfall’s game" (9384) with: warfall. Settings: map: SXRPG CastleOfCantar era: SX_RPG_Era XP: GPV: fog: shroud: observers: no shuffle: no timer: 20120326 19:27:06< lobby> Hola a todos 20120326 19:27:22< lobby> WebbSeven ended game: "WebbSeven's game" (9380) at turn: 3 with reason: 'aborted'. (socket: 14395) 20120326 19:27:24< dicplobby> 20120326 19:27:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 19:27:25< lobby> Polonia started game: "Gra użytkownika Polonia" (9374) with: Polonia, newkoas, plowman, Sioux, Epicuro, xela. Settings: map: Colosseum_scenario era: Colosseum_Extended_era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 19:27:56< lobby> Judge-dead advanced game: "Jeu de Judge-dead" (9373) with: Judge-dead. Settings: map: 01_world era: XP: GPV: fog: shroud: observers: shuffle: timer: 20120326 19:28:01< lobby> Karacole started game: "Karacole’s game" (9383) with: Karacole, zamuniel. Settings: map: multiplayer_Castle_Hopping_Isle era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 19:28:07< lobby> Judge-dead advanced game: "Jeu de Judge-dead" (9373) with: Judge-dead. Settings: map: 02_battle era: XP: GPV: fog: shroud: observers: shuffle: timer: 20120326 19:29:03< lobby> Calandryl ended game: "1x1, 2 kings each, random, no newb" (9288) at turn: 20 with reason: 'game over'. (socket: 14238) 20120326 19:29:08< lobby> can someone make survival? 20120326 19:29:17< lobby> k-yu ended game: "nome de danpe" (9181) at turn: 24 with reason: 'aborted'. (socket: 13944) 20120326 19:30:05< tuxlobby> 20120326 19:30:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 19:30:13< lobby> 20120326 19:30:12 Statistics: number_of_games = 50 number_of_users = 162 lobby_users = 36 20120326 19:30:15< lobby> Velociraptor ended game: "La partida de Velociraptor" (9350) at turn: 19 with reason: 'game over'. (socket: 14314) 20120326 19:30:17< lobby> Glandouillette ended game: "Jeu de Belton" (9334) at turn: 15 with reason: 'aborted'. (socket: 14300) 20120326 19:31:15< lobby> vollhonk started game: "vollhonk’s game" (9385) with: vollhonk, oleandria, Madmoo, orgo. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 19:31:20< lobby> halou 20120326 19:31:35< lobby> the5th started game: "the5ths Partie (SXRPG ADDOn is needed)" (9382) with: the5th, aori, icaros, yep. Settings: map: SXRPG WizardOfWarII era: Ageless RPG Era XP: 130 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 19:31:47< lobby> halouhou 20120326 19:31:54< lobby> Panfil-Ugly started game: "Игра Panfil-Ugly" (9388) with: Panfil-Ugly, FiMiAM. Settings: map: ice era: era_default XP: 50 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 19:32:20< lobby> NightAblaze ended game: "Gretik’s game" (9303) at turn: 11 with reason: 'game over'. (socket: 14269) 20120326 19:32:24< dicplobby> 20120326 19:32:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 19:33:41< lobby> Orgasm ended game: "Orgasm’s game" (9305) at turn: 13 with reason: 'game over'. (socket: 14262) 20120326 19:33:56< lobby> Judge-dead advanced game: "Jeu de Judge-dead" (9373) with: Judge-dead. Settings: map: 01_world era: XP: GPV: fog: shroud: observers: shuffle: timer: 20120326 19:34:10< lobby> Judge-dead ended game: "Jeu de Judge-dead" (9373) at turn: 1 with reason: 'game over'. (socket: 14373) 20120326 19:34:35< lobby> michi323 ended game: "Demon626s Partie" (9369) at turn: 10 with reason: 'aborted'. (socket: 14066) 20120326 19:35:06< tuxlobby> 20120326 19:35:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 19:35:12< lobby> 20120326 19:35:12 Statistics: number_of_games = 51 number_of_users = 164 lobby_users = 35 20120326 19:35:20< lobby> Judge-dead started game: "Jeu de Judge-dead" (9396) with: Judge-dead. Settings: map: SXRPG TheEvilDead era: era_default XP: 130 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 19:35:27< lobby> WebbSeven started game: "WebbSeven's game" (9395) with: WebbSeven. Settings: map: user_map era: (A New Land Classic)A New Land:Expanded.0 XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 19:35:42< lobby> WebbSeven ended game: "WebbSeven's game" (9395) at turn: 1 with reason: 'aborted'. (socket: 14426) 20120326 19:35:53< lobby> Dankovski ended game: "Игра Dankovski" (9344) at turn: 12 with reason: 'game over'. (socket: 13559) 20120326 19:36:00< lobby> 4ubaits ended game: "MuDuck" (9331) at turn: 9 with reason: 'aborted'. (socket: 14134) 20120326 19:36:03< lobby> mach mal eins auf ob ich beitreten kann 20120326 19:36:16< lobby> DrunkenStyle ended game: "chocoboner’s 2v1v2" (9335) at turn: 19 with reason: 'game over'. (socket: 14315) 20120326 19:36:53< lobby> Yaverot ended game: "VVaiting thoste" (9219) at turn: 16 with reason: 'out of sync' and disconnected. (socket: 14138) 20120326 19:37:03< lobby> kJudas ended game: "Kleshs Partie" (9224) at turn: 17 with reason: 'game over'. (socket: 14155) 20120326 19:37:12< lobby> MuDuck started game: "MuDuck" (9397) with: MuDuck, triger, 4ubaits. Settings: map: TGQ_Scenario1_Homeland era: TGQ_era XP: 100 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 19:37:24< dicplobby> 20120326 19:37:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 19:37:45< lobby> TheMAze ended game: "TheMAze’s game" (9301) at turn: 12 with reason: 'aborted'. (socket: 14125) 20120326 19:37:47< lobby> Alfeno started game: "Bat" (9400) with: Alfeno, Therden, LordKordonas, fensy. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 19:38:15< lobby> ksz ended game: "hraje Soni" (9222) at turn: 26 with reason: 'out of sync'. (socket: 14002) 20120326 19:38:28< lobby> Demon626 started game: "Demon626s Partie" (9401) with: Demon626, Ru5S1yYaZyk, soyvirgen. Settings: map: multiplayer_Hexcake era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 19:38:31< lobby> JC-D ended game: "RANDOM ONLY - XP30% - Free for all !" (9347) at turn: 14 with reason: 'game over'. (socket: 13506) 20120326 19:38:47< lobby> soyvirgen ended game: "Demon626s Partie" (9401) at turn: 1 with reason: 'aborted'. (socket: 14326) 20120326 19:40:06< tuxlobby> 20120326 19:40:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 19:40:12< lobby> 20120326 19:40:12 Statistics: number_of_games = 46 number_of_users = 158 lobby_users = 35 20120326 19:40:18< lobby> mtw169 started game: "mtw169s Partie" (9404) with: mtw169, Schattenklau. Settings: map: wultiplayer_Northerners_RPG era: era_heroes XP: 30 GPV: fog: shroud: observers: no shuffle: yes timer: 20120326 19:40:29< lobby> enombr started game: "Jeu de enombr" (9393) with: enombr, Glandouillette. Settings: map: multiplayer_Castle_Hopping_Isle era: Ageless Era XP: 30 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 19:40:30< lobby> Demon626 started game: "Demon626s Partie" (9405) with: Demon626, michi323. Settings: map: multiplayer_Castle_Hopping_Isle era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 19:40:33< lobby> Gretik started game: "Gretik’s game" (9399) with: Gretik, NightAblaze, Rl201210, doomsday101. Settings: map: isars_blasphemy era: era_default XP: 60 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 19:40:55< lobby> bentosushi started game: "bentosushi’s game" (9402) with: bentosushi, Ru5S1yYaZyk, soyvirgen, Predator, Charles_Br, RailroadBill. Settings: map: multiplayer_6p_Team_Survival era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 19:41:02< lobby> Epicuro ended game: "Gra użytkownika Polonia" (9374) at turn: 7 with reason: 'aborted'. (socket: 14278) 20120326 19:41:11< lobby> Marshall881 started game: "COLOSEUM AGELESS RPG!" (9386) with: Marshall881, Velociraptor, KeijoK. Settings: map: Colosseum_scenario era: Ageless RPG Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 19:41:17< lobby> Schattenklau ended game: "mtw169s Partie" (9404) at turn: 1 with reason: 'aborted'. (socket: 14425) 20120326 19:41:37< lobby> Tatiana started game: "Tatiana’s game" (9407) with: Tatiana, meganoob. Settings: map: (A New Land Classic)The Great Wall era: (A New Land Classic)A New Land:Expanded.0 XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 19:41:38< lobby> sega ended game: "Игра sega" (9346) at turn: 27 with reason: 'game over'. (socket: 14184) 20120326 19:41:42< lobby> Judge-dead ended game: "Jeu de Judge-dead" (9396) at turn: 6 with reason: 'aborted'. (socket: 14373) 20120326 19:42:15< lobby> Judge-dead started game: "Jeu de Judge-dead" (9412) with: Judge-dead. Settings: map: SXRPG WizardOfWarII era: era_default XP: 130 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 19:42:22< lobby> mtw169 started game: "mtw169s Partie" (9410) with: mtw169, Schattenklau. Settings: map: wultiplayer_Northerners_RPG era: era_heroes XP: 30 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 19:42:24< dicplobby> 20120326 19:42:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 19:43:28< lobby> Spider_HU started game: "Spider_HU játéka" (9413) with: Spider_HU, Elwisek. Settings: map: vs_Survival_2p era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 19:43:59< lobby> Schattenklau ended game: "mtw169s Partie" (9410) at turn: 1 with reason: 'aborted'. (socket: 14425) 20120326 19:44:30< lobby> Smozes ended game: "Wicia777’s game" (9359) at turn: 7 with reason: 'game over'. (socket: 14187) 20120326 19:45:06< tuxlobby> 20120326 19:45:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 19:45:12< lobby> 20120326 19:45:12 Statistics: number_of_games = 48 number_of_users = 154 lobby_users = 34 20120326 19:46:12< lobby> renegade13 ended game: "only players who know this map/era " (9370) at turn: 7 with reason: 'aborted'. (socket: 14372) 20120326 19:46:53< lobby> Wicia777 started game: "Wicia777’s game" (9416) with: Wicia777, Smozes, Clebermiguel, Godsmatico. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 19:47:12< lobby> mtw169 started game: "mtw169s Partie" (9415) with: mtw169, Schattenklau. Settings: map: wultiplayer_Northerners_RPG era: era_heroes XP: 30 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 19:47:24< dicplobby> 20120326 19:47:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 19:47:26< lobby> Sioux started game: "nome de Sioux" (9414) with: Sioux, Polonia, newkoas, aerrow, ksz, china. Settings: map: Colosseum_scenario era: Colosseum_Extended_era XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 19:47:48< lobby> boobz started game: "boobz" (9420) with: boobz, hateech. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 19:47:51< lobby> hay206 ended game: "Know the campaign - Diff: General + XP era" (9204) at turn: 12 with reason: 'game over'. (socket: 13999) 20120326 19:48:09< lobby> IPS started game: "Deathmatch!" (9419) with: IPS, NanRage, xela, khiM. Settings: map: mini_4p_new_dm era: Colosseum_era XP: 60 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 19:48:11< lobby> boobz ended game: "boobz" (9420) at turn: 1 with reason: 'aborted'. (socket: 14456) 20120326 19:48:40< lobby> Khomam started game: "Jeu de Khomam" (9422) with: Khomam. Settings: map: SXC_Advanced_0.2.98 era: Ageless Era XP: 130 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 19:48:41< lobby> boobz started game: "Игра boobz" (9421) with: boobz, hateech. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 19:48:53< lobby> Clow ended game: "Clows Partie" (9364) at turn: 18 with reason: 'aborted'. (socket: 14010) 20120326 19:49:15< lobby> kkk ended game: "china’s game" (9339) at turn: 12 with reason: 'aborted'. (socket: 14061) 20120326 19:49:57< lobby> evea ended game: "Mike’s game" (9349) at turn: 20 with reason: 'game over'. (socket: 13663) 20120326 19:50:05< tuxlobby> 20120326 19:50:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 19:50:12< lobby> 20120326 19:50:12 Statistics: number_of_games = 48 number_of_users = 162 lobby_users = 37 20120326 19:50:37< lobby> Resident_Stevil ended game: "I am seriousy non-F'N-beatable. Get humiiated" (9112) at turn: 17 with reason: 'aborted' and disconnected. (socket: 13961) 20120326 19:50:52< lobby> Auran started game: "tyut" (9424) with: Auran, Hakun, Mike, TheMAze, kickass, Ascorbik. Settings: map: Creep War v0.2.11.1 era: era_default XP: 60 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 19:50:52< lobby> Clow started game: "Clows Partie" (9425) with: Clow. Settings: map: World_Conquest_Start era: Ageless Heroes XP: 30 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 19:51:44< lobby> aori ended game: "the5ths Partie (SXRPG ADDOn is needed)" (9382) at turn: 8 with reason: 'aborted'. (socket: 13981) 20120326 19:52:05< lobby> WhiteTiger ended game: "Game survival" (9311) at turn: 43 with reason: 'game over'. (socket: 14004) 20120326 19:52:06< lobby> kkk started game: "nome de kkk" (9427) with: kkk. Settings: map: 2vs2Survival era: era_default XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 19:52:07< lobby> chocoboner started game: "chocoboner’s 2v1v2" (9423) with: chocoboner, ShamHammer, skarlatus, Narcissus-Pontius. Settings: map: user_map era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 19:52:13< lobby> kkk ended game: "nome de kkk" (9427) at turn: 12 with reason: 'aborted'. (socket: 14061) 20120326 19:52:22< lobby> KeijoK ended game: "COLOSEUM AGELESS RPG!" (9386) at turn: 4 with reason: 'aborted'. (socket: 14387) 20120326 19:52:24< dicplobby> 20120326 19:52:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 19:53:07< lobby> KeijoK started game: "KeijoK’n peli" (9430) with: KeijoK. Settings: map: prison_break era: Ageless Era XP: 60 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 19:53:39< lobby> RailroadBill ended game: "bentosushi’s game" (9402) at turn: 3 with reason: 'aborted'. (socket: 14355) 20120326 19:54:26< lobby> KeijoK ended game: "KeijoK’n peli" (9430) at turn: 2 with reason: 'aborted'. (socket: 14387) 20120326 19:54:36< lobby> the5th started game: "the5ths Partie (sxRPG addon is need and no quitters)" (9428) with: the5th, M_aX, aori, yep. Settings: map: SXRPG WizardOfWarII era: Ageless RPG Era XP: 130 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 19:55:05< tuxlobby> 20120326 19:55:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 19:55:12< lobby> 20120326 19:55:12 Statistics: number_of_games = 47 number_of_users = 160 lobby_users = 37 20120326 19:55:35< lobby> Beljuril started game: "Jeu de Beljuril" (9432) with: Beljuril, Charles_Br, evea. Settings: map: Dov_MP_Orocia era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 19:56:39< lobby> Marshall881 started game: "Colosseum" (9429) with: Marshall881, Epicuro, Elwisek, KeijoK, GroberKeiler. Settings: map: Colosseum_scenario era: Ageless RPG Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 19:57:25< dicplobby> 20120326 19:57:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 19:57:31< lobby> Tomino started game: "Tomino-ova hra" (9435) with: Tomino. Settings: map: multiplayer_Serpent_Ford era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 19:57:39< lobby> Tomino ended game: "Tomino-ova hra" (9435) at turn: 1 with reason: 'aborted'. (socket: 14473) 20120326 19:58:11< lobby> thefalcon222 started game: "thefalcon222’s game" (9434) with: thefalcon222, Gustavel. Settings: map: multiplayer_Hamlets era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 19:58:59< lobby> Applethree started game: "Applethree’s game" (9438) with: Applethree, Ollowain. Settings: map: multiplayer_2p_Dark_Forecast era: era_default XP: 100 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 19:59:33< lobby> Camero ended game: "Battaglia di Alfeno" (9357) at turn: 10 with reason: 'aborted'. (socket: 13866) 20120326 19:59:48< lobby> RailroadBill started game: "Игра RailroadBill" (9440) with: RailroadBill, nipnop. Settings: map: vs_Survival_2p era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:00:05< tuxlobby> 20120326 20:00:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 20:00:30< lobby> 20120326 20:00:30 Statistics: number_of_games = 50 number_of_users = 171 lobby_users = 43 20120326 20:00:35< lobby> Judge-dead ended game: "Jeu de Judge-dead" (9412) at turn: 6 with reason: 'aborted' and disconnected. (socket: 14373) 20120326 20:00:57< lobby> ottó 20120326 20:01:02< lobby> ottó 20120326 20:01:14< lobby> JomskyPonsky ended game: "Droggelbechers Partie" (9161) at turn: 54 with reason: 'game over'. (socket: 13880) 20120326 20:01:18< lobby> 11 20120326 20:01:36< lobby> ottó 20120326 20:01:38< lobby> Dhill ended game: "icaros’s game" (9198) at turn: 26 with reason: 'aborted'. (socket: 14096) 20120326 20:01:45< lobby> Schattenklau ended game: "mtw169s Partie" (9415) at turn: 5 with reason: 'aborted'. (socket: 14425) 20120326 20:01:52< lobby> orgo ended game: "vollhonk’s game" (9385) at turn: 7 with reason: 'aborted'. (socket: 14128) 20120326 20:02:24< dicplobby> 20120326 20:02:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 20:02:48< lobby> ottó 20120326 20:03:39< lobby> Spider_HU ended game: "Spider_HU játéka" (9413) at turn: 2 with reason: 'aborted' and disconnected. (socket: 14436) 20120326 20:03:53< lobby> cső 20120326 20:03:55< lobby> végre 20120326 20:04:13< lobby> blablabla started game: "Ladder" (9445) with: blablabla, ilbard. Settings: map: RMP_Classic era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:04:26< lobby> Spider_HU started game: "Spider_HU játéka" (9450) with: Spider_HU, Flashback. Settings: map: vs_Survival_2p era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:04:33< lobby> lanzaloT started game: "2vs2" (9446) with: lanzaloT, Madmoo, Paxe, Mywish. Settings: map: multiplayer_Castle_Hopping_Isle era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 20:04:41< lobby> blablabla advanced game: "Ladder" (9445) with: blablabla, ilbard. Settings: map: RMP_Sullas_Ruins_21 era: XP: 70 GPV: fog: shroud: observers: shuffle: timer: 20120326 20:04:47< lobby> renegade13 started game: "only players who knew this map/era" (9418) with: renegade13, Acheron. Settings: map: (A New Land Classic)The Great Wall era: (A New Land Classic)A New Land:Standard XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:05:05< tuxlobby> 20120326 20:05:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 20:05:30< lobby> 20120326 20:05:30 Statistics: number_of_games = 48 number_of_users = 170 lobby_users = 44 20120326 20:05:54< lobby> bentosushi started game: "bentosushi’s game" (9443) with: bentosushi, Camero, mortalenemy, CleverFool, dennycrane. Settings: map: multiplayer_Auction-X era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:06:11< lobby> kelenz ended game: "SXC" (9326) at turn: 31 with reason: 'aborted'. (socket: 13915) 20120326 20:06:38< lobby> Tomino started game: "Tomino-ova hra" (9452) with: Tomino, PEDRODAKING. Settings: map: World_Conquest_Start era: era_default XP: 80 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:07:10< lobby> PEDRODAKING ended game: "Tomino-ova hra" (9452) at turn: 1 with reason: 'aborted'. (socket: 14503) 20120326 20:07:10< lobby> universe started game: "Jeu de universe" (9453) with: universe, Mentat, screwtop. Settings: map: vs_Survival_3p era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:07:24< dicplobby> 20120326 20:07:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 20:07:29< lobby> Godsmatico ended game: "Wicia777’s game" (9416) at turn: 6 with reason: 'aborted'. (socket: 14453) 20120326 20:07:30< lobby> Tomino started game: "Tomino-ova hra" (9457) with: Tomino. Settings: map: Ultimate_onis era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:08:18< lobby> Tomino ended game: "Tomino-ova hra" (9457) at turn: 4 with reason: 'aborted'. (socket: 14537) 20120326 20:08:46< lobby> icaros started game: "icaros’s game" (9456) with: icaros, kelenz, Marem, Ank. Settings: map: SXC_CursedLand_0.2.98 era: Ageless RPG Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:09:45< lobby> Kalyra started game: "La partida de Kalyra" (9460) with: Kalyra, WhiteTiger. Settings: map: vs_Survival_2p era: Dov_XP_Mod XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:10:05< tuxlobby> 20120326 20:10:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 20:10:16< lobby> Ank ended game: "icaros’s game" (9456) at turn: 1 with reason: 'game over'. (socket: 14482) 20120326 20:10:30< lobby> 20120326 20:10:30 Statistics: number_of_games = 53 number_of_users = 171 lobby_users = 37 20120326 20:11:16< lobby> Wicia777 started game: "Wicia777’s game" (9458) with: Wicia777, Godsmatico, Smozes, Prokon. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:11:25< lobby> SuicideGirl started game: "I am seriously non-F'N-beatable. Get humiliated" (9464) with: SuicideGirl, The_Naked_One, mortalenemy, mysticknight. Settings: map: multiplayer_Clash era: era_default XP: 90 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:11:33< lobby> WhiteTiger ended game: "La partida de Kalyra" (9460) at turn: 1 with reason: 'aborted'. (socket: 14540) 20120326 20:11:44< lobby> 0_o ended game: "Rob’s game" (9333) at turn: 16 with reason: 'game over'. (socket: 14316) 20120326 20:11:57< lobby> Clow advanced game: "Clows Partie" (9425) with: Clow. Settings: map: TL_WC_NM_Island2 era: XP: 80 GPV: fog: shroud: observers: shuffle: timer: 20120326 20:11:58< lobby> _NiCo_ advanced game: "WC NIGHTMARE join if u have played this before" (9271) with: _NiCo_, Miguel, Pumdumplumbum. Settings: map: TL_WC_NM_Island2 era: XP: 80 GPV: fog: shroud: observers: shuffle: timer: 20120326 20:12:08< lobby> Kalyra started game: "La partida de Kalyra" (9466) with: Kalyra, WhiteTiger. Settings: map: vs_Survival_2p era: Dov_XP_Mod XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:12:21< lobby> icaros started game: "icaros’s game" (9463) with: icaros, Marem, kelenz, Ank. Settings: map: SXC_CursedLand_0.2.98 era: Ageless RPG Era XP: 130 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:12:24< dicplobby> 20120326 20:12:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 20:12:34< lobby> dennycrane started game: "random" (9459) with: dennycrane, Mywish, Volvo_S40, oleandria. Settings: map: user_map era: era_default XP: 50 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:12:52< lobby> Tomino started game: "Tomino-ova hra" (9469) with: Tomino. Settings: map: multiplayer_Random_Map_Winter era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:13:12< lobby> Tomino ended game: "Tomino-ova hra" (9469) at turn: 1 with reason: 'aborted'. (socket: 14551) 20120326 20:13:17< lobby> Flashback started game: "Flashback játéka" (9470) with: Flashback, Spider_HU2. Settings: map: vs_Survival_2p era: era_default XP: GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 20:13:35< lobby> aori ended game: "the5ths Partie (sxRPG addon is need and no quitters)" (9428) at turn: 7 with reason: 'aborted'. (socket: 13981) 20120326 20:13:42< lobby> Tomino started game: "Tomino-ova hra" (9472) with: Tomino. Settings: map: World_Conquest_Start era: era_default XP: 80 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:13:54< lobby> Tomino ended game: "Tomino-ova hra" (9472) at turn: 1 with reason: 'aborted'. (socket: 14551) 20120326 20:14:28< lobby> Vercingetorige advanced game: "NIGHTMARE WC, only players who know the map" (9285) with: Vercingetorige, osap, aljuma1. Settings: map: TL_WC_NM_Island2 era: XP: 80 GPV: fog: shroud: observers: shuffle: timer: 20120326 20:14:44< lobby> LordKordonas ended game: "Bat" (9400) at turn: 12 with reason: 'game over'. (socket: 14430) 20120326 20:15:05< tuxlobby> 20120326 20:15:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 20:15:06< lobby> the5th started game: "the5ths Partie" (9473) with: the5th, M_aX, yep, aori. Settings: map: SXRPG WizardOfWarII era: Ageless RPG Era XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:15:35< lobby> 20120326 20:15:35 Statistics: number_of_games = 53 number_of_users = 170 lobby_users = 32 20120326 20:15:55< lobby> pol 20120326 20:16:30< lobby> Ikerpeta ended game: "Jeu de Conscience" (9361) at turn: 13 with reason: 'aborted'. (socket: 14058) 20120326 20:17:09< lobby> Pagan started game: "Pagan’s game - now elves" (9475) with: Pagan. Settings: map: vs_Survival_2p era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:17:24< dicplobby> 20120326 20:17:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 20:17:38< lobby> zamuniel ended game: "Karacole’s game" (9383) at turn: 14 with reason: 'game over'. (socket: 14402) 20120326 20:18:05< lobby> aljuma1 ended game: "NIGHTMARE WC, only players who know the map" (9285) at turn: 1 with reason: 'game over'. (socket: 14337) 20120326 20:18:27< lobby> ladder anyone? 20120326 20:18:34< lobby> WarDuck ended game: "Durr’s game" (9377) at turn: 17 with reason: 'game over'. (socket: 14394) 20120326 20:18:34< lobby> Karacole started game: "Karacole’s game" (9477) with: Karacole, zamuniel. Settings: map: multiplayer_The_Wilderlands era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:18:37< lobby> Clow ended game: "Clows Partie" (9425) at turn: 3 with reason: 'game over' and disconnected. (socket: 14010) 20120326 20:18:37< lobby> Vercingetorige started game: "WC NIGHTMARE" (9478) with: Vercingetorige, aljuma1, osap. Settings: map: TL_WC_NM_Island2 era: era_default XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:18:46< lobby> tsar started game: "tsar’s game - experienced players please" (9474) with: tsar, LordKordonas, kriller. Settings: map: 3pSurvival era: era_heroes XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:19:11< lobby> Эй ёптаа!! 20120326 20:19:13< lobby> aori ended game: "the5ths Partie" (9473) at turn: 8 with reason: 'aborted'. (socket: 13981) 20120326 20:19:22< lobby> ы 20120326 20:19:38< lobby> Tomino started game: "Tomino-ova hra" (9479) with: Tomino. Settings: map: Colosseum_scenario era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:19:44< lobby> gungho started game: "gungho’s game" (9471) with: gungho, Ru5S1yYaZyk, Master_Mash, basiir, kuruption, torgul. Settings: map: Colosseum_scenario era: Colosseum_Extended_era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:19:46< lobby> Spider_HU2 ended game: "Flashback játéka" (9470) at turn: 11 with reason: 'aborted'. (socket: 14558) 20120326 20:19:51< lobby> пацанчик слышь дай семок 20120326 20:20:05< tuxlobby> 20120326 20:20:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 20:20:17< lobby> na hosztolj 20120326 20:20:18< lobby> :D 20120326 20:20:22< lobby> Leprucio started game: "La partida de Leprucio" (9465) with: Leprucio, DavidTNT. Settings: map: multiplayer_Fallenstar_Lake era: era_default XP: 30 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:20:23< lobby> hello 20120326 20:20:24< lobby> izé 20120326 20:20:27< lobby> nincs survivalom 20120326 20:20:27< lobby> xD 20120326 20:20:32< lobby> xDD 20120326 20:20:35< lobby> 20120326 20:20:35 Statistics: number_of_games = 53 number_of_users = 172 lobby_users = 35 20120326 20:20:37< lobby> azért nem volt jó akk 20120326 20:20:38< lobby> töltök le mindjárt 20120326 20:20:43< lobby> na hajrá 20120326 20:20:46< lobby> jystin started game: "jystin’s game" (9441) with: jystin, Pokemon-fan. Settings: map: World_Conquest_Start era: era_default XP: 60 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:20:50< lobby> Tomino ended game: "Tomino-ova hra" (9479) at turn: 1 with reason: 'aborted'. (socket: 14570) 20120326 20:20:53< lobby> Oli ended game: "GL & HF" (9372) at turn: 16 with reason: 'game over'. (socket: 14351) 20120326 20:20:55< lobby> michi323 ended game: "Demon626s Partie" (9405) at turn: 18 with reason: 'aborted'. (socket: 14066) 20120326 20:21:09< lobby> the5th started game: "the5ths Partie" (9480) with: the5th, yep, M_aX, aori. Settings: map: SXRPG WizardOfWarII era: Ageless RPG Era XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:21:30< lobby> nipnop ended game: "Игра RailroadBill" (9440) at turn: 9 with reason: 'aborted'. (socket: 14498) 20120326 20:21:44< lobby> xela ended game: "Deathmatch!" (9419) at turn: 62 with reason: 'game over'. (socket: 14389) 20120326 20:21:45< lobby> vagyok 20120326 20:21:48< lobby> ok 20120326 20:21:51< lobby> 0_o started game: "nome de 0_o" (9481) with: 0_o, fensy, kalenz, Camero. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:22:01< lobby> dennycrane started game: "random" (9482) with: dennycrane, NanRage, termit, nipnop. Settings: map: user_map era: era_default XP: 50 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:22:24< dicplobby> 20120326 20:22:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 20:22:51< lobby> richard_wang ended game: "richard_wang的游戏" (9211) at turn: 41 with reason: 'game over'. (socket: 14127) 20120326 20:23:01< lobby> Flashback started game: "Flashback játéka" (9487) with: Flashback, Spider_HU2. Settings: map: 3pSurvival era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 20:23:05< lobby> Spider_HU2 ended game: "Flashback játéka" (9487) at turn: 1 with reason: 'aborted'. (socket: 14582) 20120326 20:23:07< lobby> lol 20120326 20:23:07< lobby> Tomino started game: "Tomino-ova hra" (9484) with: Tomino, PEDRODAKING. Settings: map: Colosseum_scenario era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 20:23:10< lobby> kell hozzá izé is 20120326 20:23:11< lobby> lool 20120326 20:23:12< lobby> Oli started game: "game" (9485) with: Oli, Kamzor, ShadowVeil, Neuromancer. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:23:13< lobby> mi a szar 20120326 20:23:16< lobby> era 20120326 20:23:18< lobby> era 20120326 20:23:18< lobby> azaz 20120326 20:23:20< lobby> pill 20120326 20:23:28< lobby> hateech ended game: "Игра boobz" (9421) at turn: 12 with reason: 'aborted'. (socket: 14452) 20120326 20:23:28< lobby> de várj 20120326 20:23:29< lobby> jystin advanced game: "jystin’s game" (9441) with: jystin, Pokemon-fan. Settings: map: TL_WC_NM_Island2 era: XP: 80 GPV: fog: shroud: observers: shuffle: timer: 20120326 20:23:31< lobby> nekem nincs meg 20120326 20:24:01< lobby> boobz started game: "boobz" (9489) with: boobz, hateech. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:24:52< lobby> nah vagyok 20120326 20:25:05< tuxlobby> 20120326 20:25:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 20:25:35< lobby> 20120326 20:25:35 Statistics: number_of_games = 56 number_of_users = 172 lobby_users = 27 20120326 20:25:39< lobby> WebbSeven started game: "WebbSevens Partie" (9493) with: WebbSeven. Settings: map: user_map era: (A New Land Classic)A New Land:Standard XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 20:25:51< lobby> WebbSeven ended game: "WebbSevens Partie" (9493) at turn: 1 with reason: 'aborted'. (socket: 14590) 20120326 20:25:54< lobby> widowmaker80 started game: "Ladder" (9483) with: widowmaker80, tomtom. Settings: map: RMP_All era: RBY No Mirror XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 20:26:02< lobby> widowmaker80 advanced game: "Ladder" (9483) with: widowmaker80, tomtom. Settings: map: RMP_Howling_Ghost_Badlands_12 era: XP: 70 GPV: fog: shroud: observers: shuffle: timer: 20120326 20:26:03< lobby> Spider_HU ended game: "Spider_HU játéka" (9450) at turn: 4 with reason: 'aborted' and disconnected. (socket: 14530) 20120326 20:26:47< lobby> Mmatthew ended game: "Mmatthew’s game" (9318) at turn: 19 with reason: 'aborted' and disconnected. (socket: 14289) 20120326 20:27:20< lobby> Isar started game: "hraje Isar" (9491) with: Isar, Ryu, Calandryl, hetial. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:27:21< lobby> Argi started game: "Gra użytkownika Argi" (9490) with: Argi, Fari. Settings: map: 2vs2Survival era: era_default XP: 50 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 20:27:24< lobby> Flashback started game: "Flashback játéka" (9492) with: Flashback, Ikerpeta, ges55, Spider_HU. Settings: map: isars_blasphemy era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 20:27:24< dicplobby> 20120326 20:27:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 20:28:10< lobby> Joeisidle started game: "Joeisidle’s game" (9486) with: Joeisidle, paddyisidle. Settings: map: multiplayer_Sablestone_Delta era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:28:13< lobby> WebbSeven started game: "WebbSeven's game" (9495) with: WebbSeven. Settings: map: user_map era: (A New Land Classic)A New Land:Expanded.0 XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 20:28:22< lobby> WebbSeven ended game: "WebbSeven's game" (9495) at turn: 1 with reason: 'aborted'. (socket: 14596) 20120326 20:30:05< tuxlobby> 20120326 20:30:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 20:30:28< lobby> Amarok23 started game: "Amarok23s Partie" (9496) with: Amarok23, neji, joell. Settings: map: Dov_MP_Orocia era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:30:35< lobby> 20120326 20:30:35 Statistics: number_of_games = 57 number_of_users = 175 lobby_users = 29 20120326 20:30:41< lobby> Ikerpeta ended game: "Flashback játéka" (9492) at turn: 1 with reason: 'aborted'. (socket: 14058) 20120326 20:30:44< lobby> Miguis started game: "nome de Miguis" (9500) with: Miguis. Settings: map: Colosseum_scenario era: Colosseum_era XP: 30 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:30:55< lobby> MuDuck advanced game: "MuDuck" (9397) with: MuDuck, triger, 4ubaits. Settings: map: TGQ_Scenario2_Ravine era: XP: 100 GPV: fog: shroud: observers: shuffle: timer: 20120326 20:30:58< lobby> the5th started game: "the5ths Partie (sxaddon needed)" (9494) with: the5th. Settings: map: SXRPG WizardOfWarII era: Ageless RPG Era XP: 130 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:31:17< lobby> neji ended game: "Amarok23s Partie" (9496) at turn: 1 with reason: 'aborted'. (socket: 14545) 20120326 20:31:31< lobby> PEDRODAKING ended game: "Tomino-ova hra" (9484) at turn: 4 with reason: 'aborted'. (socket: 14583) 20120326 20:31:33< lobby> Zenzsei ended game: "fefelixs Partie" (9353) at turn: 39 with reason: 'aborted'. (socket: 14345) 20120326 20:32:07< lobby> Tomino started game: "Tomino-ova hra" (9503) with: Tomino, PEDRODAKING. Settings: map: Colosseum_scenario era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 20:32:10< lobby> mengluo ended game: "mengluo’s game" (9304) at turn: 45 with reason: 'aborted'. (socket: 14141) 20120326 20:32:24< dicplobby> 20120326 20:32:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 20:32:53< lobby> Miguis ended game: "nome de Miguis" (9500) at turn: 3 with reason: 'aborted'. (socket: 14592) 20120326 20:33:12< lobby> Flashback started game: "Flashback játéka" (9505) with: Flashback, Spider_HU. Settings: map: vs_Survival_2p era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 20:33:25< lobby> Amarok23 started game: "Amarok23s Partie" (9501) with: Amarok23, neji, zen. Settings: map: Dov_MP_Orocia era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:33:52< lobby> doomsday101 ended game: "Gretik’s game" (9399) at turn: 11 with reason: 'aborted'. (socket: 14435) 20120326 20:33:55< lobby> shapeshifter3 ended game: "mad hosting mode" (9121) at turn: 43 with reason: 'aborted'. (socket: 14046) 20120326 20:34:16< lobby> oleandria ended game: "random" (9459) at turn: 15 with reason: 'game over'. (socket: 14407) 20120326 20:34:58< lobby> monst started game: "Degeso" (9502) with: monst, pipefox, xomberry. Settings: map: SXRPG TheEvilDead era: Ageless RPG Era XP: 130 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:35:05< tuxlobby> 20120326 20:35:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 20:35:26< lobby> Silian started game: "Battaglia di Silian" (9508) with: Silian, Vincentius. Settings: map: 3D era: era_default XP: 60 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 20:35:35< lobby> 20120326 20:35:35 Statistics: number_of_games = 55 number_of_users = 172 lobby_users = 37 20120326 20:35:46< lobby> WhiteTiger ended game: "La partida de Kalyra" (9466) at turn: 14 with reason: 'aborted'. (socket: 14540) 20120326 20:37:02< lobby> enombr ended game: "Jeu de enombr" (9393) at turn: 13 with reason: 'aborted'. (socket: 14422) 20120326 20:37:08< lobby> PEDRODAKING ended game: "Tomino-ova hra" (9503) at turn: 4 with reason: 'aborted'. (socket: 14583) 20120326 20:37:25< dicplobby> 20120326 20:37:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 20:37:42< lobby> Tomino started game: "Tomino-ova hra" (9515) with: Tomino, PEDRODAKING. Settings: map: Colosseum_scenario era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 20:38:21< lobby> El_Gor started game: "Игра El_Gor" (9513) with: El_Gor, GrandFil, Dankovski. Settings: map: vs_Survival_3p era: Ageless Era XP: 30 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:38:39< lobby> mengluo started game: "mengluo’s game" (9506) with: mengluo, lanceleau, LuizBR1, Ranimiro, kavalji. Settings: map: SXC_MountainsOfDoom_0.2.98 era: Ageless RPG Era XP: 150 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:38:49< lobby> Agra started game: "Gra użytkownika Agra" (9510) with: Agra, Rkof, icaros. Settings: map: 3pSurvival era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:39:19< lobby> Ranimiro ended game: "mengluo’s game" (9506) at turn: 1 with reason: 'game over'. (socket: 14632) 20120326 20:39:41< lobby> huehne started game: "huehnes Partie" (9519) with: huehne, joell, Prokon, kavalji. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:40:05< tuxlobby> 20120326 20:40:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 20:40:35< lobby> 20120326 20:40:35 Statistics: number_of_games = 57 number_of_users = 178 lobby_users = 37 20120326 20:41:22< lobby> mengluo started game: "mengluo’s game" (9521) with: mengluo, lanceleau, Ranimiro, LuizBR1, kelenz. Settings: map: SXC_MountainsOfDoom_0.2.98 era: Ageless RPG Era XP: 130 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:41:24< lobby> wtf 20120326 20:41:56< lobby> spelare started game: "spelares spel" (9517) with: spelare, jeppe. Settings: map: Dov_MP_Rumble3D era: Dov_Drops_Mod XP: 40 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:42:17< lobby> SHUTUP 20120326 20:42:24< dicplobby> 20120326 20:42:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 20:42:35< lobby> universe started game: "Jeu de universe" (9525) with: universe. Settings: map: multiplayer_A_New_Land era: pure_strategy_era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:43:00< lobby> universe ended game: "Jeu de universe" (9525) at turn: 1 with reason: 'aborted'. (socket: 13763) 20120326 20:44:22< lobby> jeppe ended game: "spelares spel" (9517) at turn: 4 with reason: 'aborted'. (socket: 14639) 20120326 20:44:56< lobby> spelare started game: "spelares spel" (9528) with: spelare, jeppe. Settings: map: Dov_MP_Rumble3D era: Dov_XP_Mod XP: 40 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:45:05< tuxlobby> 20120326 20:45:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 20:45:30< lobby> Charles_Br ended game: "Jeu de Beljuril" (9432) at turn: 10 with reason: 'aborted'. (socket: 14050) 20120326 20:45:39< lobby> 20120326 20:45:39 Statistics: number_of_games = 55 number_of_users = 178 lobby_users = 41 20120326 20:46:29< lobby> Gustavel ended game: "thefalcon222’s game" (9434) at turn: 13 with reason: 'aborted'. (socket: 14484) 20120326 20:46:47< lobby> Mentat ended game: "Jeu de universe" (9453) at turn: 12 with reason: 'aborted'. (socket: 14476) 20120326 20:47:17< lobby> renegade13 ended game: "only players who knew this map/era" (9418) at turn: 9 with reason: 'aborted'. (socket: 14372) 20120326 20:47:24< dicplobby> 20120326 20:47:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 20:47:32< lobby> NanRage ended game: "random" (9482) at turn: 10 with reason: 'aborted' and disconnected. (socket: 14385) 20120326 20:47:44< lobby> paddyisidle ended game: "Joeisidle’s game" (9486) at turn: 2 with reason: 'aborted' and disconnected. (socket: 14588) 20120326 20:47:52< lobby> dennycrane started game: "random" (9527) with: dennycrane, termit, Polycentropsis, abhijit. Settings: map: user_map era: era_default XP: 50 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:48:00< lobby> Pokemon-fan ended game: "jystin’s game" (9441) at turn: 7 with reason: 'game over'. (socket: 14571) 20120326 20:48:04< lobby> Rkof ended game: "Gra użytkownika Agra" (9510) at turn: 3 with reason: 'aborted'. (socket: 14126) 20120326 20:48:53< dicplobby> Dark_Master has logged on. (socket: 71) 20120326 20:49:00< dicplobby> Angel66 has logged on. (socket: 72) 20120326 20:49:01< dicplobby> Dark_Master has logged off. (socket: 71) 20120326 20:49:06< dicplobby> Angel66 has logged off. (socket: 72) 20120326 20:49:13< tuxlobby> Angel66 has logged on. (socket: 25239) 20120326 20:49:17< tuxlobby> Angel66 has logged off. (socket: 25239) 20120326 20:49:21< lobby> Marshall881 started game: "Gra użytkownika Marshall881" (9530) with: Marshall881. Settings: map: multiplayer_Auction-X era: Ageless RPG Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:49:27< lobby> clap ended game: "clap’s game" (9143) at turn: 19 with reason: 'aborted' and disconnected. (socket: 14030) 20120326 20:49:37< dicplobby> Angel66 has logged on. (socket: 73) 20120326 20:49:38< lobby> Marshall881 ended game: "Gra użytkownika Marshall881" (9530) at turn: 1 with reason: 'aborted'. (socket: 14343) 20120326 20:49:44< lobby> jystin started game: "jystin’s game" (9533) with: jystin, Pokemon-fan. Settings: map: TT_01_attack_to_elf_city era: era_default XP: 30 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:49:46< lobby> Agra started game: "Gra użytkownika Agra" (9532) with: Agra, Rkof, Mentat. Settings: map: 3pSurvival era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:50:01< dicplobby> Angel66 has logged off. (socket: 73) 20120326 20:50:02< lobby> pipefox ended game: "Degeso" (9502) at turn: 2 with reason: 'aborted'. (socket: 14643) 20120326 20:50:05< tuxlobby> 20120326 20:50:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 20:50:26< lobby> Marshall881 started game: "Gra użytkownika Marshall881" (9535) with: Marshall881. Settings: map: multiplayer_Auction-X era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:50:39< lobby> 20120326 20:50:39 Statistics: number_of_games = 51 number_of_users = 159 lobby_users = 51 20120326 20:51:23< lobby> 4ubaits ended game: "MuDuck" (9397) at turn: 1 with reason: 'game over' and disconnected. (socket: 14134) 20120326 20:51:38< lobby> KeijoK ended game: "Colosseum" (9429) at turn: 16 with reason: 'aborted'. (socket: 14387) 20120326 20:52:24< dicplobby> 20120326 20:52:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 20:52:34< lobby> jeppe ended game: "spelares spel" (9528) at turn: 8 with reason: 'game over'. (socket: 14639) 20120326 20:52:41< lobby> jboogie started game: "jboogie’s game" (9542) with: jboogie, irene. Settings: map: multiplayer_Cynsaun_Battlefield era: era_default XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:52:42< lobby> Applethree ended game: "Applethree’s game" (9438) at turn: 30 with reason: 'aborted'. (socket: 14490) 20120326 20:52:43< lobby> IloSophiep started game: "IloSophieps Partie" (9540) with: IloSophiep, maehlager. Settings: map: multiplayer_Paths_of_Daggers era: era_default XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:52:43< lobby> Ranimiro started game: "La partida de Ranimiro" (9536) with: Ranimiro, GroberKeiler, kelenz. Settings: map: SXC_Maze_0.2.97 era: Ageless RPG Era XP: 130 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:52:50< lobby> how to load muptiplayer game? 20120326 20:52:58< lobby> monst started game: "Игра monst" (9539) with: monst, pipefox, xomberry. Settings: map: SXRPG TheEvilDead era: Ageless RPG Era XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:53:08< lobby> tomterror started game: "tomterror’s game" (9538) with: tomterror, Hakuna, evea. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:53:21< lobby> blablabla ended game: "Ladder" (9445) at turn: 12 with reason: 'game over'. (socket: 14515) 20120326 20:53:25< lobby> spelare started game: "spelares spel" (9543) with: spelare, jeppe. Settings: map: Dov_MP_Rumble3D era: Dov_XP_Mod XP: 40 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:53:40< lobby> AMoose started game: "AMoose’s game" (9545) with: AMoose, bacord, nipnop. Settings: map: multiplayer_Island_of_the_Horatii era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:54:18< lobby> Wicia777 ended game: "Wicia777’s game" (9458) at turn: 10 with reason: 'game over'. (socket: 14146) 20120326 20:54:21< lobby> create a game, and at the top of the list, there's a "load a game" 20120326 20:54:27< lobby> Blysk started game: "Gra użytkownika Blysk" (9546) with: Blysk, Franiu. Settings: map: multiplayer_Hamlets era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:54:33< lobby> M_aX ended game: "the5ths Partie" (9480) at turn: 17 with reason: 'aborted'. (socket: 14414) 20120326 20:54:40< lobby> kuruption ended game: "gungho’s game" (9471) at turn: 13 with reason: 'aborted'. (socket: 14659) 20120326 20:54:48< lobby> chocoboner ended game: "chocoboner’s 2v1v2" (9423) at turn: 5 with reason: 'aborted'. (socket: 14461) 20120326 20:55:06< tuxlobby> 20120326 20:55:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 20:55:31< lobby> Argi12148 started game: "Gra użytkownika Argi12148" (9548) with: Argi12148, Chujciwdupe. Settings: map: 2vs2Survival era: era_default XP: GPV: fog: shroud: observers: no shuffle: no timer: 20120326 20:55:39< lobby> 20120326 20:55:39 Statistics: number_of_games = 55 number_of_users = 171 lobby_users = 45 20120326 20:56:01< lobby> Hakuna ended game: "tomterror’s game" (9538) at turn: 1 with reason: 'aborted'. (socket: 14489) 20120326 20:56:06< lobby> kelenz ended game: "La partida de Ranimiro" (9536) at turn: 2 with reason: 'aborted'. (socket: 13915) 20120326 20:56:15< lobby> Marem ended game: "icaros’s game" (9463) at turn: 17 with reason: 'aborted'. (socket: 14533) 20120326 20:56:21< lobby> renegade13 started game: "ONLY good ANL Players!" (9529) with: renegade13, Polonia, Zbikoo. Settings: map: (A New Land Classic)The Great Wall era: (A New Land Classic)A New Land:Standard XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:56:25< lobby> KalenzZ started game: "Jeu de KalenzZ" (9552) with: KalenzZ, Xplosivman. Settings: map: CSABI_The_Valley_of_the_Fear era: Ageless Era XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:56:39< lobby> tomterror started game: "tomterror’s game" (9555) with: tomterror, evea, Hakuna, Kaentar. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:56:47< lobby> mengluo123 started game: "mengluo123’s game" (9537) with: mengluo123, lanceleau, LuizBR, Stego, Wicia777. Settings: map: SXC_SpoOky_Forest_0.2.98 era: Ageless RPG Era XP: 130 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:57:09< lobby> Zeplin started game: "Zeplins Partie" (9553) with: Zeplin, Lenning. Settings: map: multiplayer_Random_Map era: era_default XP: 80 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:57:11< lobby> Limon started game: "nome de Limon" (9557) with: Limon. Settings: map: multiplayer_Howling_Ghost_Badlands era: era_default XP: 30 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 20:57:24< dicplobby> 20120326 20:57:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 20:57:29< lobby> ladder anyone??? 20120326 20:59:43< lobby> Godsmatico started game: "La partida de Godsmatico" (9560) with: Godsmatico, Zenzsei, soyvirgen. Settings: map: multiplayer_Island_of_the_Horatii era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:59:49< lobby> Isar started game: "hraje Isar" (9562) with: Isar, kickass, jin7, lio. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 20:59:55< lobby> mihkelh started game: "mihkelh’s game" (9559) with: mihkelh, t4. Settings: map: multiplayer_Forest_of_Fear era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 21:00:06< tuxlobby> 20120326 21:00:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 21:00:56< lobby> 20120326 21:00:56 Statistics: number_of_games = 57 number_of_users = 169 lobby_users = 34 20120326 21:01:03< lobby> Fari ended game: "Gra użytkownika Argi" (9490) at turn: 8 with reason: 'aborted' and disconnected. (socket: 14593) 20120326 21:01:12< lobby> Ishimi ended game: "nome de Ishimi" (9294) at turn: 30 with reason: 'aborted'. (socket: 14033) 20120326 21:01:13< lobby> zen ended game: "Amarok23s Partie" (9501) at turn: 4 with reason: 'aborted' and disconnected. (socket: 14620) 20120326 21:01:21< lobby> SirFoxALot started game: "SirFoxALots Partie" (9403) with: SirFoxALot, FireWario. Settings: map: multiplayer_Silverhead_Crossing era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 21:01:21< lobby> mengluo ended game: "mengluo’s game" (9521) at turn: 1 with reason: 'aborted' and disconnected. (socket: 14141) 20120326 21:01:36< lobby> Griffith started game: "Griffiths Partie (SXADDON needed ) " (9551) with: Griffith, M_aX, Ranimiro, Ninjahase, icaros. Settings: map: SXRPG WizardOfWarII era: Ageless RPG Era XP: 130 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 21:01:38< lobby> Camero ended game: "nome de 0_o" (9481) at turn: 9 with reason: 'aborted' and disconnected. (socket: 13866) 20120326 21:01:43< lobby> the5th ended game: "the5ths Partie (sxaddon needed)" (9494) at turn: 8 with reason: 'aborted' and disconnected. (socket: 14290) 20120326 21:01:44< lobby> Khomam ended game: "Jeu de Khomam" (9422) at turn: 27 with reason: 'aborted' and disconnected. (socket: 14459) 20120326 21:02:25< dicplobby> 20120326 21:02:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 21:03:21< lobby> jeppe ended game: "spelares spel" (9543) at turn: 10 with reason: 'game over'. (socket: 14639) 20120326 21:03:46< lobby> jystin advanced game: "jystin’s game" (9533) with: jystin, Pokemon-fan. Settings: map: TT_02_the_castle era: XP: GPV: fog: shroud: observers: shuffle: timer: 20120326 21:03:49< lobby> PEDRODAKING ended game: "Tomino-ova hra" (9515) at turn: 15 with reason: 'aborted'. (socket: 14583) 20120326 21:03:50< lobby> Limon ended game: "nome de Limon" (9557) at turn: 8 with reason: 'aborted'. (socket: 14702) 20120326 21:03:51< lobby> Miguis started game: "nome de Miguis" (9561) with: Miguis, Cyofero. Settings: map: war_of_chaos_2pruined_cove era: Colosseum_era XP: 30 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 21:03:54< lobby> spelare started game: "spelares spel" (9564) with: spelare, jeppe. Settings: map: Dov_MP_Rumble3D era: Dov_XP_Mod XP: 40 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 21:04:07< lobby> Cyofero ended game: "nome de Miguis" (9561) at turn: 1 with reason: 'aborted'. (socket: 14729) 20120326 21:04:13< lobby> Tomino started game: "Tomino-ova hra" (9565) with: Tomino, PEDRODAKING. Settings: map: Colosseum_scenario era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 21:04:20< lobby> Limon started game: "nome de Limon" (9566) with: Limon. Settings: map: SXC_Adventure_0.2.98 era: era_default XP: 130 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 21:04:21< lobby> Marshall881 ended game: "Gra użytkownika Marshall881" (9535) at turn: 7 with reason: 'game over'. (socket: 14343) 20120326 21:04:29< lobby> Neuromancer ended game: "game" (9485) at turn: 7 with reason: 'game over'. (socket: 14580) 20120326 21:04:43< lobby> Limon ended game: "nome de Limon" (9566) at turn: 1 with reason: 'aborted'. (socket: 14702) 20120326 21:05:05< tuxlobby> 20120326 21:05:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 21:05:23< lobby> Miguis started game: "nome de Miguis" (9567) with: Miguis, Cyofero. Settings: map: 2vs2Survival era: Colosseum_era XP: 30 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 21:05:37< lobby> Cyofero ended game: "nome de Miguis" (9567) at turn: 1 with reason: 'aborted'. (socket: 14729) 20120326 21:05:42< lobby> Hope started game: "SUrvival" (9563) with: Hope, speler. Settings: map: ice era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 21:05:56< lobby> 20120326 21:05:56 Statistics: number_of_games = 49 number_of_users = 163 lobby_users = 36 20120326 21:06:01< lobby> basiir started game: "shuffle side - 330 sec,timer -no quitter -random" (9554) with: basiir, screwtop, Volvo_S40, kelenz, Marshall881, Volvo_V40. Settings: map: Creep War 3 Teams v0.2.11.1 era: Ageless RPG Era XP: 60 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 21:06:11< lobby> Miguis started game: "nome de Miguis" (9571) with: Miguis, Cyofero. Settings: map: 2vs2Survival era: Colosseum_era XP: 30 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 21:06:17< lobby> speler ended game: "SUrvival" (9563) at turn: 1 with reason: 'aborted'. (socket: 14723) 20120326 21:06:21< lobby> Miguis ended game: "nome de Miguis" (9571) at turn: 1 with reason: 'aborted'. (socket: 14592) 20120326 21:06:21< lobby> Neuromancer started game: "Neuromancer’s game" (9568) with: Neuromancer, Camero0, Sightlock, darky. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 21:06:41< lobby> Hope started game: "Gra użytkownika Hope" (9572) with: Hope, speler. Settings: map: ice era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 21:07:16< lobby> Miguis started game: "nome de Miguis" (9573) with: Miguis, Cyofero. Settings: map: 2vs2Survival era: Colosseum_era XP: 30 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 21:07:21< lobby> Limon started game: "nome de Limon" (9574) with: Limon. Settings: map: Adrian_survival era: era_default XP: 30 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 21:07:24< dicplobby> 20120326 21:07:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 21:08:05< lobby> El_Gor ended game: "Игра El_Gor" (9513) at turn: 6 with reason: 'aborted'. (socket: 14608) 20120326 21:09:02< lobby> joell ended game: "huehnes Partie" (9519) at turn: 7 with reason: 'aborted'. (socket: 14609) 20120326 21:09:25< lobby> maehlager ended game: "IloSophieps Partie" (9540) at turn: 16 with reason: 'game over'. (socket: 14657) 20120326 21:09:58< lobby> Cyofero ended game: "nome de Miguis" (9573) at turn: 4 with reason: 'game over'. (socket: 14729) 20120326 21:10:05< tuxlobby> 20120326 21:10:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 21:10:43< lobby> integra started game: "wars_of_nyak" (9577) with: integra, disasm. Settings: map: multiplayer_Aethermaw era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 21:10:56< lobby> 20120326 21:10:56 Statistics: number_of_games = 51 number_of_users = 166 lobby_users = 41 20120326 21:12:09< lobby> widowmaker80 ended game: "Ladder" (9483) at turn: 11 with reason: 'game over'. (socket: 14575) 20120326 21:12:14< lobby> lipk started game: "lipk's game - feel free to join" (9576) with: lipk, WhiteTiger. Settings: map: multiplayer_Silverhead_Crossing era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 21:12:21< lobby> Kpp ended game: "Ladder (registration required)" (9332) at turn: 23 with reason: 'game over'. (socket: 14293) 20120326 21:12:24< dicplobby> 20120326 21:12:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 21:12:26< lobby> al started game: "al’s game" (9579) with: al, goollumm, kilopop, AKkran. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 21:13:12< lobby> universe started game: "Jeu de universe" (9582) with: universe. Settings: map: World_Conquest_Start era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 21:13:37< lobby> DuirOak started game: "3p surv" (9581) with: DuirOak, werul, neji2. Settings: map: 3pSurvival era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 21:13:47< lobby> Miguis started game: "nome de Miguis" (9580) with: Miguis, Cyofero. Settings: map: 3pSurvival era: Ageless Era XP: 30 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 21:13:55< lobby> Mentat ended game: "Gra użytkownika Agra" (9532) at turn: 10 with reason: 'aborted'. (socket: 14476) 20120326 21:13:58< lobby> universe ended game: "Jeu de universe" (9582) at turn: 1 with reason: 'aborted'. (socket: 14750) 20120326 21:14:14< lobby> priya91 started game: "priya91’s game" (9583) with: priya91, psweet. Settings: map: multiplayer_Blue_Water_Province era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 21:14:43< lobby> Agra started game: "Gra użytkownika Agra" (9584) with: Agra, Johnnybaker, Mentat. Settings: map: 3pSurvival era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 21:15:05< tuxlobby> 20120326 21:15:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 21:15:14< lobby> Flashback ended game: "Flashback játéka" (9505) at turn: 16 with reason: 'game over'. (socket: 14619) 20120326 21:15:26< lobby> Johnnybaker ended game: "Gra użytkownika Agra" (9584) at turn: 1 with reason: 'aborted'. (socket: 14758) 20120326 21:15:38< lobby> Agra started game: "Gra użytkownika Agra" (9586) with: Agra, Johnnybaker, Mentat. Settings: map: 3pSurvival era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 21:15:57< lobby> 20120326 21:15:57 Statistics: number_of_games = 50 number_of_users = 163 lobby_users = 42 20120326 21:17:07< lobby> disasm ended game: "wars_of_nyak" (9577) at turn: 1 with reason: 'game over'. (socket: 14732) 20120326 21:17:24< dicplobby> 20120326 21:17:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 21:18:41< lobby> jeppe ended game: "spelares spel" (9564) at turn: 10 with reason: 'aborted'. (socket: 14639) 20120326 21:18:42< lobby> Polycentropsis ended game: "random" (9527) at turn: 13 with reason: 'game over'. (socket: 14647) 20120326 21:18:46< lobby> integra started game: "Игра integra" (9588) with: integra, disasm. Settings: map: multiplayer_Alirok_Marsh era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 21:18:57< lobby> universe started game: "Jeu de universe" (9589) with: universe. Settings: map: World_Conquest_Start era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 21:19:04< lobby> Limon ended game: "nome de Limon" (9574) at turn: 10 with reason: 'aborted'. (socket: 14702) 20120326 21:19:28< lobby> universe ended game: "Jeu de universe" (9589) at turn: 1 with reason: 'aborted'. (socket: 14750) 20120326 21:19:30< lobby> hateech ended game: "boobz" (9489) at turn: 18 with reason: 'game over'. (socket: 14452) 20120326 21:19:35< lobby> bentosushi ended game: "bentosushi’s game" (9443) at turn: 16 with reason: 'aborted'. (socket: 14371) 20120326 21:19:38< lobby> Ryu ended game: "hraje Isar" (9491) at turn: 17 with reason: 'game over'. (socket: 14591) 20120326 21:19:39< lobby> Limon started game: "nome de Limon" (9590) with: Limon. Settings: map: Heroic_Last_Stand_scenario era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 21:19:42< lobby> Limon ended game: "nome de Limon" (9590) at turn: 1 with reason: 'aborted'. (socket: 14702) 20120326 21:20:05< tuxlobby> 20120326 21:20:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 21:20:27< lobby> goollumm ended game: "al’s game" (9579) at turn: 4 with reason: 'aborted'. (socket: 14751) 20120326 21:20:57< lobby> 20120326 21:20:57 Statistics: number_of_games = 42 number_of_users = 162 lobby_users = 59 20120326 21:21:30< lobby> integra ended game: "Игра integra" (9588) at turn: 2 with reason: 'aborted'. (socket: 14740) 20120326 21:21:52< lobby> goollumm started game: "goollumms Partie" (9591) with: goollumm, Buff, shakebear, Polycentropsis. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 21:22:24< dicplobby> 20120326 21:22:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 21:22:42< lobby> The_Naked_One ended game: "I am seriously non-F'N-beatable. Get humiliated" (9464) at turn: 9 with reason: 'aborted' and disconnected. (socket: 14521) 20120326 21:22:50< lobby> Smoczek started game: "Gra użytkownika Smoczek" (9592) with: Smoczek. Settings: map: multiplayer_Arcanclave_Citadel era: era_magic_masters_0.18.0 XP: 30 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 21:22:51< lobby> lanzaloT ended game: "2vs2" (9446) at turn: 16 with reason: 'game over'. (socket: 14421) 20120326 21:23:03< lobby> lipk ended game: "lipk's game - feel free to join" (9576) at turn: 7 with reason: 'game over'. (socket: 14738) 20120326 21:23:12< lobby> jystin advanced game: "jystin’s game" (9533) with: jystin, Pokemon-fan. Settings: map: TT_03_tarqensis era: XP: GPV: fog: shroud: observers: shuffle: timer: 20120326 21:23:23< lobby> psweet ended game: "priya91’s game" (9583) at turn: 3 with reason: 'aborted'. (socket: 14761) 20120326 21:23:43< lobby> fail started game: "La partida de fail" (9595) with: fail. Settings: map: 2vs2Survival era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 21:25:03< lobby> jystin advanced game: "jystin’s game" (9533) with: jystin, Pokemon-fan. Settings: map: TT_04_the_mountain era: XP: GPV: fog: shroud: observers: shuffle: timer: 20120326 21:25:05< tuxlobby> 20120326 21:25:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 21:25:33< lobby> speler ended game: "Gra użytkownika Hope" (9572) at turn: 9 with reason: 'game over'. (socket: 14723) 20120326 21:25:57< lobby> 20120326 21:25:57 Statistics: number_of_games = 47 number_of_users = 165 lobby_users = 52 20120326 21:26:01< lobby> bighood started game: "2v2" (9597) with: bighood, kilopop, Khomam, Wicia777. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 21:26:05< lobby> priya91 started game: "priya91’s game" (9598) with: priya91, psweet. Settings: map: multiplayer_Loris_River era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 21:26:20< lobby> Chujciwdupe ended game: "Gra użytkownika Argi12148" (9548) at turn: 15 with reason: 'aborted'. (socket: 14694) 20120326 21:26:37< lobby> Argi12148 started game: "Gra użytkownika Argi12148" (9600) with: Argi12148, Chujciwdupe. Settings: map: 2vs2Survival era: era_default XP: GPV: fog: shroud: observers: no shuffle: no timer: 20120326 21:26:42< lobby> Stonemender started game: "Stonemenders Partie" (9594) with: Stonemender, Coexistence, Fix3l. Settings: map: multiplayer_Hexcake era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 21:26:55< lobby> goldsurfer98 started game: "goldsurfer98s Partie" (9602) with: goldsurfer98, GheddoChris. Settings: map: TT_01_attack_to_elf_city era: era_default XP: 30 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 21:27:03< lobby> bacord ended game: "AMoose’s game" (9545) at turn: 15 with reason: 'game over'. (socket: 14682) 20120326 21:27:06< lobby> Hope started game: "Gra użytkownika Hope" (9601) with: Hope, speler. Settings: map: ice era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 21:27:22< lobby> Flarix started game: "Flarix’s game" (9603) with: Flarix, bacord, Gogoth, lio. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 21:27:24< dicplobby> 20120326 21:27:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 21:29:04< lobby> torben started game: "torbens Partie" (9608) with: torben, Crendgrim. Settings: map: multiplayer_elensefar_courtyard era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 21:29:57< lobby> Smoczek ended game: "Gra użytkownika Smoczek" (9592) at turn: 7 with reason: 'aborted'. (socket: 14773) 20120326 21:30:00< lobby> universe started game: "Jeu de universe" (9611) with: universe. Settings: map: Conquest Europe era: GLEE XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 21:30:05< tuxlobby> 20120326 21:30:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 21:30:13< lobby> Mentat ended game: "Gra użytkownika Agra" (9586) at turn: 6 with reason: 'aborted'. (socket: 14476) 20120326 21:30:23< lobby> Agra started game: "Gra użytkownika Agra" (9612) with: Agra, Johnnybaker, Mentat. Settings: map: 3pSurvival era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 21:30:53< lobby> FireWario ended game: "SirFoxALots Partie" (9403) at turn: 11 with reason: 'game over'. (socket: 14417) 20120326 21:30:57< lobby> 20120326 21:30:57 Statistics: number_of_games = 52 number_of_users = 171 lobby_users = 50 20120326 21:31:11< lobby> please make a Survival some one 20120326 21:31:12< lobby> boobz started game: "boobz" (9613) with: boobz, hateech. Settings: map: multiplayer_4p_Morituri era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 21:31:22< lobby> universe ended game: "Jeu de universe" (9611) at turn: 1 with reason: 'aborted'. (socket: 14811) 20120326 21:31:33< lobby> please? 20120326 21:31:54< lobby> icaros ended game: "Griffiths Partie (SXADDON needed ) " (9551) at turn: 7 with reason: 'out of sync'. (socket: 14726) 20120326 21:32:12< lobby> universe started game: "Jeu de universe" (9616) with: universe. Settings: map: Conquest Wesnoth era: GLEE XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 21:32:22< lobby> Irmao-Verdade started game: "1 vs 1 . two sides each" (9610) with: Irmao-Verdade, Roger, nipnop. Settings: map: multiplayer_4p_Underworld era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 21:32:24< dicplobby> 20120326 21:32:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 21:32:56< lobby> Flarix started game: "Flarix’s game" (9614) with: Flarix, jschmidtBR, lio, Tahartagl. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 21:33:48< lobby> universe ended game: "Jeu de universe" (9616) at turn: 1 with reason: 'aborted'. (socket: 14811) 20120326 21:33:51< lobby> Chujciwdupe ended game: "Gra użytkownika Argi12148" (9600) at turn: 17 with reason: 'aborted'. (socket: 14694) 20120326 21:34:10< lobby> Cyofero ended game: "nome de Miguis" (9580) at turn: 9 with reason: 'aborted'. (socket: 14729) 20120326 21:34:15< lobby> Argi12148 started game: "Gra użytkownika Argi12148" (9622) with: Argi12148, Chujciwdupe. Settings: map: 2vs2Survival era: era_default XP: GPV: fog: shroud: observers: no shuffle: no timer: 20120326 21:34:48< lobby> Griffith started game: "Griffiths remake (SXRPGADDON needed)" (9618) with: Griffith, Tobain, icaros, M_aX, Ranimiro. Settings: map: SXRPG WizardOfWarII era: Ageless RPG Era XP: 130 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 21:35:02< lobby> universe started game: "Jeu de universe" (9623) with: universe. Settings: map: World_Conquest_Start era: Conquest Era5 XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 21:35:05< lobby> universe ended game: "Jeu de universe" (9623) at turn: 1 with reason: 'aborted'. (socket: 14811) 20120326 21:35:05< tuxlobby> 20120326 21:35:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 21:35:13< lobby> Miguis started game: "nome de Miguis" (9619) with: Miguis, Cyofero. Settings: map: Colosseum_scenario era: Ageless Era XP: 30 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 21:35:28< lobby> t4 ended game: "mihkelh’s game" (9559) at turn: 8 with reason: 'aborted'. (socket: 14709) 20120326 21:35:57< lobby> 20120326 21:35:57 Statistics: number_of_games = 55 number_of_users = 177 lobby_users = 45 20120326 21:35:58< lobby> mihkelh started game: "mihkelh’s game" (9625) with: mihkelh, t4. Settings: map: multiplayer_Forest_of_Fear era: era_default XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 21:36:03< lobby> EpicFailGuy started game: "EpicFailGuys Partie" (9624) with: EpicFailGuy. Settings: map: SXRPG CastleOfCantar era: SX RPG Era XP: 200 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 21:36:22< lobby> universe started game: "Jeu de universe" (9627) with: universe. Settings: map: vs_Survival_2p era: Ageless RPG Era XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 21:36:26< lobby> EpicFailGuy ended game: "EpicFailGuys Partie" (9624) at turn: 1 with reason: 'game over'. (socket: 14825) 20120326 21:36:46< lobby> universe ended game: "Jeu de universe" (9627) at turn: 1 with reason: 'aborted'. (socket: 14811) 20120326 21:36:54< lobby> CRAZYpotato started game: "CRAZYpotatos RUMBLE" (9617) with: CRAZYpotato, KLASHINKOOV, al, MeSSiaH. Settings: map: mini_4p_new_dm era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 21:37:01< lobby> paso started game: "Jeu de paso" (9626) with: paso. Settings: map: 3pSurvival era: Dov_XP_Mod XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 21:37:12< lobby> universe started game: "Jeu de universe" (9632) with: universe. Settings: map: vs_Survival_2p era: SX_RPG_Era XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 21:37:15< lobby> Radar started game: "milites.pl i druzyna warki czerwonej 5,7% alkoholu" (9621) with: Radar, drakow, Zbikoo. Settings: map: 3pSurvival era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 21:37:24< dicplobby> 20120326 21:37:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 21:37:27< lobby> universe ended game: "Jeu de universe" (9632) at turn: 1 with reason: 'aborted'. (socket: 14811) 20120326 21:37:44< lobby> EpicFailGuy started game: "EpicFailGuys Partie" (9630) with: EpicFailGuy. Settings: map: SXRPG CastleOfCantar era: era_heroes XP: 130 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 21:38:00< lobby> Leprucio ended game: "La partida de Leprucio" (9465) at turn: 24 with reason: 'game over'. (socket: 14543) 20120326 21:38:02< lobby> han started game: "La partida de han" (9628) with: han, GroberKeiler, universe. Settings: map: vs_Survival_3p era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 21:39:17< lobby> Schafan started game: "Schafans Partie" (9599) with: Schafan, Daszto. Settings: map: SXC_Classic_0.2.98 era: Ageless Era XP: 130 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 21:39:31< lobby> Isar started game: "hraje Isar" (9605) with: Isar, polu, mortalenemy, vector. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 21:40:05< tuxlobby> 20120326 21:40:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 21:40:06< lobby> Argi12148 ended game: "Gra użytkownika Argi12148" (9622) at turn: 17 with reason: 'aborted'. (socket: 14796) 20120326 21:40:40< lobby> paso ended game: "Jeu de paso" (9626) at turn: 1 with reason: 'aborted'. (socket: 14828) 20120326 21:40:57< lobby> 20120326 21:40:57 Statistics: number_of_games = 56 number_of_users = 183 lobby_users = 37 20120326 21:41:16< lobby> Leprucio started game: "La partida de Leprucio" (9637) with: Leprucio, DavidTNT. Settings: map: multiplayer_Sullas_Ruins era: era_default XP: 30 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 21:41:30< lobby> pos_no started game: "La partida de pos_no" (9636) with: pos_no, ofire. Settings: map: multiplayer_Random_Map era: era_default XP: 30 GPV: fog: shroud: observers: no shuffle: yes timer: 20120326 21:41:39< lobby> Kalyra started game: "La partida de Kalyra" (9640) with: Kalyra, sagi3347. Settings: map: vs_Survival_2p era: Dov_XP_Mod XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 21:42:25< dicplobby> 20120326 21:42:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 21:43:24< lobby> nate-the-great started game: "nate-the-great’s game" (9641) with: nate-the-great. Settings: map: isars_blasphemy era: Ageless Era XP: 60 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 21:43:47< lobby> renegade13 ended game: "ONLY good ANL Players!" (9529) at turn: 10 with reason: 'aborted'. (socket: 14372) 20120326 21:44:13< lobby> Nissarin started game: "MadMode@" (9634) with: Nissarin, FElo, Spyro, O_Q, GroberKeiler. Settings: map: SXC_MountainsOfDoom_0.2.98 era: sxc_default_low_level_era XP: 130 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 21:44:50< lobby> Pagan ended game: "Pagan’s game - now elves" (9475) at turn: 26 with reason: 'game over'. (socket: 14359) 20120326 21:44:51< lobby> Silian ended game: "Battaglia di Silian" (9508) at turn: 13 with reason: 'game over'. (socket: 14615) 20120326 21:45:00< lobby> Argi12148 started game: "Gra użytkownika Argi12148" (9648) with: Argi12148, Fari. Settings: map: 2vs2Survival era: era_default XP: 50 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 21:45:02< lobby> Heilige_Henk started game: "Heilige_Henk’s game" (9644) with: Heilige_Henk, Sander. Settings: map: multiplayer_4p_Hamlets era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 21:45:05< tuxlobby> 20120326 21:45:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 21:45:19< lobby> Eldirian started game: "Eldirian’s game" (9649) with: Eldirian, Profprofprof, Radin, Trecera. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 21:45:39< lobby> Pokemon-fan ended game: "jystin’s game" (9533) at turn: 11 with reason: 'game over'. (socket: 14571) 20120326 21:45:46< lobby> Godsmatico ended game: "La partida de Godsmatico" (9560) at turn: 15 with reason: 'aborted'. (socket: 14716) 20120326 21:45:57< lobby> 20120326 21:45:57 Statistics: number_of_games = 59 number_of_users = 189 lobby_users = 41 20120326 21:46:00< lobby> Trivellone started game: "Quack quack!" (9607) with: Trivellone, Nagiv. Settings: map: multiplayer_Aethermaw era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 21:46:02< lobby> jin7 ended game: "hraje Isar" (9562) at turn: 13 with reason: 'game over'. (socket: 14715) 20120326 21:46:58< lobby> host orocai 20120326 21:47:24< dicplobby> 20120326 21:47:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 21:47:44< lobby> Maxwell started game: "Maxwell’s game" (9646) with: Maxwell, Zoe. Settings: map: multiplayer_Sullas_Ruins era: Ageless Era XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 21:48:23< lobby> Snowman started game: "random" (9647) with: Snowman, kickass, jin7, Choppy. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 21:49:25< lobby> bacord ended game: "Flarix’s game" (9603) at turn: 16 with reason: 'game over'. (socket: 14682) 20120326 21:49:50< lobby> KisukeUrahara started game: "Battaglia di KisukeUrahara" (9652) with: KisukeUrahara, Slealista. Settings: map: multiplayer_4p_Morituri era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 21:50:02< lobby> Heilige_Henk1 started game: "Heilige_Henk1’s game" (9653) with: Heilige_Henk1, Sander. Settings: map: multiplayer_King_of_the_Hill era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 21:50:05< tuxlobby> 20120326 21:50:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 21:50:19< lobby> johnny started game: "nome de johnny" (9650) with: johnny, Thiagolamen. Settings: map: multiplayer_Aethermaw era: era_default XP: 50 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 21:50:23< lobby> t4 ended game: "mihkelh’s game" (9625) at turn: 5 with reason: 'aborted'. (socket: 14709) 20120326 21:50:34< lobby> Heilige_Henk1 ended game: "Heilige_Henk1’s game" (9653) at turn: 1 with reason: 'aborted'. (socket: 14861) 20120326 21:50:36< lobby> Tomino ended game: "Tomino-ova hra" (9565) at turn: 28 with reason: 'game over'. (socket: 14570) 20120326 21:50:39< lobby> mihkelh started game: "mihkelh’s game" (9655) with: mihkelh, t4. Settings: map: multiplayer_Forest_of_Fear era: era_default XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 21:50:54< lobby> Thiagolamen ended game: "nome de johnny" (9650) at turn: 1 with reason: 'aborted'. (socket: 14849) 20120326 21:50:54< lobby> EpicFailGuy ended game: "EpicFailGuys Partie" (9630) at turn: 7 with reason: 'game over'. (socket: 14825) 20120326 21:50:55< lobby> t4 ended game: "mihkelh’s game" (9655) at turn: 1 with reason: 'aborted'. (socket: 14709) 20120326 21:50:57< lobby> 20120326 21:50:57 Statistics: number_of_games = 55 number_of_users = 189 lobby_users = 46 20120326 21:51:21< lobby> Zoe ended game: "Maxwell’s game" (9646) at turn: 1 with reason: 'aborted'. (socket: 14857) 20120326 21:51:41< lobby> Vercingetorige ended game: "WC NIGHTMARE" (9478) at turn: 6 with reason: 'aborted' and disconnected. (socket: 14189) 20120326 21:51:56< lobby> goldsurfer98 advanced game: "goldsurfer98s Partie" (9602) with: goldsurfer98, GheddoChris. Settings: map: TT_02_the_castle era: XP: GPV: fog: shroud: observers: shuffle: timer: 20120326 21:52:24< dicplobby> 20120326 21:52:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 21:52:24< lobby> Heilige_Henk1 started game: "Heilige_Henk1’s game" (9656) with: Heilige_Henk1, Sander. Settings: map: multiplayer_King_of_the_Hill era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 21:52:25< lobby> EpicFailGuy started game: "EpicFailGuys Partie" (9663) with: EpicFailGuy. Settings: map: SXRPG CastleOfCantar era: era_heroes XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 21:52:27< lobby> Maxwell started game: "Maxwell’s game" (9662) with: Maxwell, Zoe. Settings: map: multiplayer_Sullas_Ruins era: Ageless Era XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 21:52:40< lobby> johnny started game: "nome de johnny" (9658) with: johnny, Thiagolamen. Settings: map: multiplayer_The_Freelands era: era_default XP: 50 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 21:53:02< lobby> mihkelh started game: "mihkelh’s game" (9657) with: mihkelh, t4. Settings: map: multiplayer_Forest_of_Fear era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 21:53:40< lobby> t4 ended game: "mihkelh’s game" (9657) at turn: 1 with reason: 'aborted'. (socket: 14709) 20120326 21:53:46< lobby> goldsurfer98 ended game: "goldsurfer98s Partie" (9602) at turn: 1 with reason: 'game over'. (socket: 14791) 20120326 21:53:54< lobby> Tahartagl ended game: "Flarix’s game" (9614) at turn: 8 with reason: 'aborted'. (socket: 14809) 20120326 21:54:31< lobby> mihkelh started game: "mihkelh’s game" (9667) with: mihkelh, t4. Settings: map: multiplayer_Forest_of_Fear era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 21:54:36< lobby> FElo ended game: "MadMode@" (9634) at turn: 2 with reason: 'aborted'. (socket: 14783) 20120326 21:54:44< lobby> Grond started game: "Grond’s game" (9639) with: Grond. Settings: map: Colosseum_scenario era: Colosseum_era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 21:54:53< lobby> Flarix started game: "Flarix’s game" (9666) with: Flarix, RickDangerous, cobo, largefood. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 21:55:05< tuxlobby> 20120326 21:55:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 21:55:52< lobby> fail ended game: "La partida de fail" (9595) at turn: 13 with reason: 'aborted'. (socket: 14787) 20120326 21:55:57< lobby> 20120326 21:55:57 Statistics: number_of_games = 58 number_of_users = 193 lobby_users = 51 20120326 21:56:22< lobby> Blysk ended game: "Gra użytkownika Blysk" (9546) at turn: 20 with reason: 'aborted'. (socket: 14701) 20120326 21:56:53< lobby> Pagan started game: "Pagan’s game" (9677) with: Pagan, plk2. Settings: map: TL_WC_NM_Island2 era: era_default XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 21:56:56< lobby> Silian started game: "Battaglia di Silian" (9675) with: Silian, SaBriNa-. Settings: map: multiplayer_Random_Map era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 21:57:24< dicplobby> 20120326 21:57:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 21:57:28< lobby> hallo felius 20120326 21:57:31< lobby> fail started game: "La partida de fail" (9679) with: fail. Settings: map: 2vs2Survival era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 21:57:32< lobby> Hakuna ended game: "tomterror’s game" (9555) at turn: 17 with reason: 'game over'. (socket: 14489) 20120326 21:57:36< lobby> sers 20120326 21:57:42< lobby> ich such gerade noch eins aus 20120326 21:57:47< lobby> jo 20120326 21:58:14< lobby> Stego ended game: "mengluo123’s game" (9537) at turn: 13 with reason: 'aborted'. (socket: 14688) 20120326 21:58:44< lobby> Felixus started game: "Felixuss Partiesersok" (9682) with: Felixus, Wolfsfell. Settings: map: multiplayer_Howling_Ghost_Badlands era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 21:58:46< lobby> hateech ended game: "boobz" (9613) at turn: 11 with reason: 'game over'. (socket: 14452) 20120326 21:59:20< lobby> boobz started game: "Игра boobz" (9685) with: boobz, hateech. Settings: map: multiplayer_Lagoon era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 21:59:24< lobby> goldsurfer98 started game: "goldsurfer98s Partie" (9681) with: goldsurfer98, GheddoChris. Settings: map: multiplayer_4p_Underworld era: era_default XP: 30 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 21:59:25< lobby> fail ended game: "La partida de fail" (9679) at turn: 2 with reason: 'aborted'. (socket: 14787) 20120326 21:59:29< lobby> boobz ended game: "Игра boobz" (9685) at turn: 1 with reason: 'aborted'. (socket: 14456) 20120326 21:59:33< lobby> Bass started game: "La partida de Bass" (9664) with: Bass, gea. Settings: map: multiplayer_Random_Map_Desert era: era_default XP: 60 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 21:59:56< lobby> Hakun ended game: "tyut" (9424) at turn: 17 with reason: 'aborted'. (socket: 14338) 20120326 21:59:56< lobby> boobz started game: "Игра boobz" (9687) with: boobz, hateech. Settings: map: multiplayer_Auction-X era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 22:00:04< lobby> boobz ended game: "Игра boobz" (9687) at turn: 1 with reason: 'aborted'. (socket: 14456) 20120326 22:00:05< tuxlobby> 20120326 22:00:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 22:00:15< lobby> mengluo123 started game: "mengluo123’s game" (9680) with: mengluo123, lanceleau, LuizBRR, wof, Stego. Settings: map: SXC_SpoOky_Forest_0.2.98 era: Ageless RPG Era XP: 130 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 22:00:15< lobby> fail started game: "La partida de fail" (9688) with: fail. Settings: map: 2vs2Survival era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 22:00:28< lobby> Grond ended game: "Grond’s game" (9639) at turn: 2 with reason: 'aborted'. (socket: 14744) 20120326 22:00:43< lobby> jveino started game: "jveino’s game" (9629) with: jveino, hen, ithaxa. Settings: map: multiplayer_The_Wilderlands era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 22:00:56< lobby> boobz started game: "Игра boobz" (9690) with: boobz, hateech. Settings: map: multiplayer_4p_Hamlets era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 22:00:58< lobby> 20120326 22:00:58 Statistics: number_of_games = 61 number_of_users = 196 lobby_users = 42 20120326 22:01:22< lobby> warfall ended game: "warfall’s game" (9384) at turn: 114 with reason: 'aborted'. (socket: 14207) 20120326 22:01:22< lobby> BlindWraith started game: "BlindWraith’s game" (9691) with: BlindWraith, Kaentar, GroberKeiler. Settings: map: 3pSurvival era: Ageless Era XP: 60 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 22:01:50< lobby> fail ended game: "La partida de fail" (9688) at turn: 2 with reason: 'aborted'. (socket: 14787) 20120326 22:02:06< lobby> Heilige_Henk ended game: "Heilige_Henk’s game" (9644) at turn: 1 with reason: 'aborted' and disconnected. (socket: 14853) 20120326 22:02:14< lobby> newkoas ended game: "nome de Sioux" (9414) at turn: 79 with reason: 'game over'. (socket: 14390) 20120326 22:02:19< lobby> fail started game: "La partida de fail" (9692) with: fail. Settings: map: 2vs2Survival era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 22:02:24< dicplobby> 20120326 22:02:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 22:03:44< lobby> EpicFailGuy ended game: "EpicFailGuys Partie" (9663) at turn: 13 with reason: 'game over'. (socket: 14825) 20120326 22:04:13< lobby> Nissarin started game: "MadMode@" (9672) with: Nissarin, O_Q, Doomb, FElo, Ranimiro. Settings: map: SXC_MountainsOfDoom_0.2.98 era: sxc_default_low_level_era XP: 130 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 22:04:29< lobby> Polonia started game: "Gra użytkownika Polonia" (9674) with: Polonia, Tommy, Aroda. Settings: map: Colosseum_scenario era: Colosseum_era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 22:05:05< tuxlobby> 20120326 22:05:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 22:05:57< lobby> nate-the-great ended game: "nate-the-great’s game" (9641) at turn: 26 with reason: 'game over'. (socket: 14848) 20120326 22:05:58< lobby> 20120326 22:05:58 Statistics: number_of_games = 56 number_of_users = 189 lobby_users = 41 20120326 22:06:10< lobby> jboogie ended game: "jboogie’s game" (9542) at turn: 26 with reason: 'game over'. (socket: 14695) 20120326 22:06:17< lobby> screwtop ended game: "shuffle side - 330 sec,timer -no quitter -random" (9554) at turn: 20 with reason: 'aborted'. (socket: 14698) 20120326 22:06:21< lobby> nate-the-great started game: "nate-the-great’s game" (9693) with: nate-the-great. Settings: map: isars_blasphemy era: Ageless Era XP: 60 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 22:06:32< lobby> Leprucio ended game: "La partida de Leprucio" (9637) at turn: 9 with reason: 'aborted'. (socket: 14844) 20120326 22:06:50-!- csarmi_home [csarmi@94-21-124-213.pool.digikabel.hu] has joined #wesnoth-mp-lobby-stable 20120326 22:07:25< dicplobby> 20120326 22:07:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 22:08:41< lobby> DuirOak ended game: "3p surv" (9581) at turn: 23 with reason: 'game over'. (socket: 14760) 20120326 22:08:43-!- csarmi [csarmi@94-21-229-175.pool.digikabel.hu] has quit [Ping timeout: 252 seconds] 20120326 22:08:43< lobby> abben started game: "abben játéka" (9686) with: abben, ErnestoJr. Settings: map: user_map era: era_leaders XP: 30 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 22:10:05< tuxlobby> 20120326 22:10:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 22:10:11< lobby> irene started game: "Battaglia di irene" (9699) with: irene, jboogie. Settings: map: multiplayer_2p_Dark_Forecast era: era_default XP: 100 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 22:10:57< lobby> 2v2 anyone? 20120326 22:10:58< lobby> 20120326 22:10:58 Statistics: number_of_games = 57 number_of_users = 183 lobby_users = 40 20120326 22:11:00< lobby> Flarix started game: "Flarix’s game" (9701) with: Flarix, UglyGrunt, Rob, gdn. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 22:11:05< lobby> KisukeUrahara ended game: "Battaglia di KisukeUrahara" (9652) at turn: 7 with reason: 'aborted'. (socket: 14871) 20120326 22:11:29< lobby> abben ended game: "abben játéka" (9686) at turn: 1 with reason: 'out of sync' and disconnected. (socket: 14906) 20120326 22:11:41< lobby> KisukeUrahara started game: "Battaglia di KisukeUrahara" (9703) with: KisukeUrahara, Slealista. Settings: map: multiplayer_4p_Morituri era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 22:11:49< lobby> han ended game: "La partida de han" (9628) at turn: 10 with reason: 'aborted'. (socket: 14833) 20120326 22:12:24< dicplobby> 20120326 22:12:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 22:12:28< lobby> Fix3l ended game: "Stonemenders Partie" (9594) at turn: 8 with reason: 'aborted'. (socket: 14785) 20120326 22:12:58< lobby> raleeha started game: "raleehas Partie" (9704) with: raleeha, universe. Settings: map: multiplayer_4p_Lucky_Sevens_V4 era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 22:13:09< lobby> Hope ended game: "Gra użytkownika Hope" (9601) at turn: 21 with reason: 'aborted'. (socket: 14725) 20120326 22:13:35< lobby> jakflash started game: "jakflash’s game" (9705) with: jakflash, nezam, Benni, screwtop. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 22:13:51< lobby> SaBriNa- ended game: "Battaglia di Silian" (9675) at turn: 8 with reason: 'aborted'. (socket: 14876) 20120326 22:14:29< lobby> Hope started game: "Gra użytkownika Hope" (9709) with: Hope. Settings: map: multiplayer_4p_Morituri era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 22:14:57< lobby> Hope ended game: "Gra użytkownika Hope" (9709) at turn: 2 with reason: 'aborted'. (socket: 14725) 20120326 22:15:06< tuxlobby> 20120326 22:15:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 22:15:49< lobby> LordKordonas ended game: "tsar’s game - experienced players please" (9474) at turn: 25 with reason: 'aborted'. (socket: 14565) 20120326 22:15:58< lobby> 20120326 22:15:58 Statistics: number_of_games = 58 number_of_users = 181 lobby_users = 47 20120326 22:15:58< lobby> Aroda ended game: "Gra użytkownika Polonia" (9674) at turn: 5 with reason: 'aborted'. (socket: 14883) 20120326 22:16:11< lobby> artifis started game: "Игра artifis" (9707) with: artifis, AnairabiS. Settings: map: Ferox_4p_Wesmere_Border_Assault era: Ageless Era XP: 50 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 22:16:11< lobby> Radin ended game: "Eldirian’s game" (9649) at turn: 10 with reason: 'game over'. (socket: 14855) 20120326 22:16:40< lobby> Nyme ended game: "Sane’n peli" (9315) at turn: 25 with reason: 'aborted'. (socket: 14283) 20120326 22:16:45< lobby> priya91 ended game: "priya91’s game" (9598) at turn: 11 with reason: 'game over'. (socket: 14759) 20120326 22:16:58< lobby> UPOCZEKAJ ZRESETUJE KOMPA 20120326 22:17:08< lobby> Eldirian started game: "Eldirian’s game" (9712) with: Eldirian, Radin, Spieler34, Scatha. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 22:17:24< dicplobby> 20120326 22:17:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 22:17:24< lobby> Kalyra started game: "La partida de Kalyra" (9714) with: clmates, Kalyra, thefish, antty. Settings: map: multiplayer_Isars_Cross era: Dov_XP_Mod XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 22:17:44< lobby> abben started game: "abben játéka" (9706) with: abben, ErnestoJr. Settings: map: user_map era: era_leaders XP: 30 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 22:17:57< lobby> Lenning ended game: "Zeplins Partie" (9553) at turn: 20 with reason: 'aborted'. (socket: 14706) 20120326 22:17:58< lobby> rumple started game: "rumple’s game" (9718) with: rumple, lunamatic. Settings: map: multiplayer_Random_Map era: era_default XP: GPV: fog: shroud: observers: no shuffle: no timer: 20120326 22:18:12< lobby> Wicia777 ended game: "2v2" (9597) at turn: 12 with reason: 'game over'. (socket: 14146) 20120326 22:18:30< lobby> Alexian started game: "Alexian’s game" (9717) with: Alexian, RodWolfus. Settings: map: multiplayer_The_Freelands era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 22:18:56< lobby> basiir started game: "basiir’s game" (9711) with: basiir, Aroda, Tommy, Polonia, Welcome2, Wicia777. Settings: map: Colosseum_scenario era: Colosseum_era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 22:19:04< lobby> RickDangerous ended game: "Flarix’s game" (9666) at turn: 7 with reason: 'aborted'. (socket: 14889) 20120326 22:19:05< lobby> ErnestoJr ended game: "abben játéka" (9706) at turn: 1 with reason: 'aborted'. (socket: 14945) 20120326 22:19:05< lobby> Maru started game: "Marus Partie" (9716) with: Maru, Coexistence, Fix3l, Stonemender. Settings: map: multiplayer_Merkwuerdigliebe era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 22:19:05< lobby> Hope started game: "2 v 2 " (9710) with: Hope, joell, Wepawetmose, FwSchulzi. Settings: map: multiplayer_4p_Morituri era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 22:19:37< lobby> Orgasm started game: "Orgasm’s game" (9720) with: Orgasm, nezam, ShamHammer, cobo. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 22:20:04< lobby> FwSchulzi ended game: "2 v 2 " (9710) at turn: 1 with reason: 'aborted'. (socket: 14931) 20120326 22:20:06< tuxlobby> 20120326 22:20:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 22:20:11< lobby> raleeha ended game: "raleehas Partie" (9704) at turn: 5 with reason: 'aborted'. (socket: 14937) 20120326 22:20:32< lobby> ShamHammer ended game: "Orgasm’s game" (9720) at turn: 1 with reason: 'aborted'. (socket: 14408) 20120326 22:20:58< lobby> 20120326 22:20:58 Statistics: number_of_games = 57 number_of_users = 187 lobby_users = 40 20120326 22:21:04< lobby> Benni ended game: "jakflash’s game" (9705) at turn: 3 with reason: 'aborted'. (socket: 14944) 20120326 22:21:06< lobby> Micco started game: "Micco’n peli" (9719) with: Micco, steeli. Settings: map: multiplayer_Island_of_the_Horatii era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 22:21:16< lobby> Orgasm started game: "Orgasm’s game" (9723) with: Orgasm, nezam, ShamHammer, Benni. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 22:21:19< lobby> Micco ended game: "Micco’n peli" (9719) at turn: 1 with reason: 'aborted'. (socket: 14953) 20120326 22:21:28< lobby> skarlatus started game: "nome de skarlatus" (9721) with: skarlatus, RickDangerous, mike, screwtop. Settings: map: Creep old alternate map version v0.2.11.1 era: Ageless RPG Era XP: 40 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 22:22:08< lobby> Yubtzock started game: "Yubtzock’s game" (9713) with: Yubtzock, joell, Paxe, Khananahn. Settings: map: multiplayer_Belgar_Peak era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 22:22:24< dicplobby> 20120326 22:22:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 22:22:34-!- noy [~Noy@wesnoth/developer/noy] has joined #wesnoth-mp-lobby-stable 20120326 22:22:37-!- mode/#wesnoth-mp-lobby-stable [+o noy] by ChanServ 20120326 22:22:56< lobby> Micco started game: "Micco’n peli" (9726) with: Micco, steeli. Settings: map: multiplayer_Island_of_the_Horatii era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 22:23:04< lobby> Micco ended game: "Micco’n peli" (9726) at turn: 1 with reason: 'aborted'. (socket: 14953) 20120326 22:23:51< lobby> raleeha started game: "raleehas Partie" (9725) with: raleeha, Wepawetmose, Gyudan, RaFa. Settings: map: prison_break era: Ageless Era XP: 60 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 22:24:06< lobby> t4 ended game: "mihkelh’s game" (9667) at turn: 9 with reason: 'aborted'. (socket: 14709) 20120326 22:24:15< lobby> Tobain ended game: "Griffiths remake (SXRPGADDON needed)" (9618) at turn: 10 with reason: 'out of sync'. (socket: 14779) 20120326 22:24:41< lobby> jakflash started game: "jakflash’s game" (9724) with: jakflash, vector, FwSchulzi. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 22:24:48< lobby> mihkelh started game: "mihkelh’s game" (9729) with: mihkelh, t4. Settings: map: multiplayer_Forest_of_Fear era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 22:24:50< lobby> vector ended game: "jakflash’s game" (9724) at turn: 1 with reason: 'aborted'. (socket: 14981) 20120326 22:24:54< lobby> bluewolf27 started game: "bluewolf27’s game" (9730) with: bluewolf27. Settings: map: multiplayer_Hamlets era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 22:25:06< tuxlobby> 20120326 22:25:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 22:25:10< lobby> Micco started game: "Micco’n peli" (9728) with: Micco, steeli. Settings: map: multiplayer_Howling_Ghost_Badlands era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 22:25:15< lobby> Pumdumplumbum ended game: "WC NIGHTMARE join if u have played this before" (9271) at turn: 16 with reason: 'game over'. (socket: 14217) 20120326 22:25:42< lobby> moonchild started game: "GL & HF" (9732) with: moonchild, vector, FwSchulzi, Pumdumplumbum. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 22:25:58< lobby> 20120326 22:25:58 Statistics: number_of_games = 59 number_of_users = 187 lobby_users = 34 20120326 22:26:11< lobby> Velociraptor started game: "La partida de Velociraptor" (9734) with: Velociraptor. Settings: map: isars_blasphemy era: Ageless Era XP: 50 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 22:26:44< lobby> Griffith started game: "Griffiths reremake (SXRpg addon needed)" (9731) with: Griffith, NanRage, Tobain, DeadlyGrim, M_aX. Settings: map: SXRPG WizardOfWarII era: Ageless RPG Era XP: 130 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 22:27:24< dicplobby> 20120326 22:27:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 22:27:48< lobby> abben started game: "abben játéka" (9727) with: abben, ErnestoJr. Settings: map: user_map era: era_leaders XP: 30 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 22:28:04< lobby> KLASHINKOOV ended game: "CRAZYpotatos RUMBLE" (9617) at turn: 62 with reason: 'game over'. (socket: 14805) 20120326 22:28:41< lobby> Fari ended game: "Gra użytkownika Argi12148" (9648) at turn: 15 with reason: 'aborted'. (socket: 14860) 20120326 22:28:53< lobby> Argi12148 started game: "Gra użytkownika Argi12148" (9737) with: Argi12148, Fari. Settings: map: 2vs2Survival era: era_default XP: GPV: fog: shroud: observers: no shuffle: no timer: 20120326 22:29:13< lobby> Fari ended game: "Gra użytkownika Argi12148" (9737) at turn: 15 with reason: 'aborted'. (socket: 14860) 20120326 22:29:24< lobby> Argi12148 started game: "Gra użytkownika Argi12148" (9738) with: Argi12148, Fari. Settings: map: 2vs2Survival era: era_default XP: GPV: fog: shroud: observers: no shuffle: no timer: 20120326 22:30:01< lobby> jakflash started game: "jakflash’s game" (9733) with: jakflash, aimp, Prokon, Camero0. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 22:30:05< tuxlobby> 20120326 22:30:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 22:30:27< lobby> anyone ladder? 20120326 22:31:03< lobby> 20120326 22:31:03 Statistics: number_of_games = 59 number_of_users = 193 lobby_users = 36 20120326 22:32:24< dicplobby> 20120326 22:32:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 22:32:59< lobby> thelegion started game: "thelegion’s game" (9740) with: thelegion. Settings: map: elf_war_1_Broken_Pact_easy era: era_default XP: 60 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 22:33:11< lobby> b00mbear started game: "b00mbears Partie" (9739) with: b00mbear, Adi. Settings: map: multiplayer_4p_Hamlets era: era_default XP: 40 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 22:33:33< lobby> CRAZYpotato started game: "CRAZYpotatos RUMBLE in the BRONXXXXX" (9736) with: CRAZYpotato, KLASHINKOOV, Nephrite, tadpol. Settings: map: mini_4p_new_dm era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 22:34:21< lobby> torben ended game: "torbens Partie" (9608) at turn: 17 with reason: 'aborted'. (socket: 14793) 20120326 22:34:28< lobby> thelegion ended game: "thelegion’s game" (9740) at turn: 1 with reason: 'aborted'. (socket: 14998) 20120326 22:34:52< lobby> Fari ended game: "Gra użytkownika Argi12148" (9738) at turn: 17 with reason: 'aborted'. (socket: 14860) 20120326 22:35:01< lobby> Argi12148 started game: "Gra użytkownika Argi12148" (9741) with: Argi12148, Fari. Settings: map: 2vs2Survival era: era_default XP: GPV: fog: shroud: observers: no shuffle: no timer: 20120326 22:35:05< tuxlobby> 20120326 22:35:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 22:35:41< lobby> Rob ended game: "Flarix’s game" (9701) at turn: 6 with reason: 'aborted'. (socket: 14924) 20120326 22:36:00< lobby> some skilled playwer for a 2v2? :) 20120326 22:36:03< lobby> 20120326 22:36:03 Statistics: number_of_games = 58 number_of_users = 195 lobby_users = 43 20120326 22:36:37< lobby> Adi ended game: "b00mbears Partie" (9739) at turn: 2 with reason: 'game over'. (socket: 14997) 20120326 22:36:42< lobby> goldsurfer98 ended game: "goldsurfer98s Partie" (9681) at turn: 8 with reason: 'aborted'. (socket: 14899) 20120326 22:37:15< lobby> Hellrider started game: "Hellrider’s game" (9742) with: Hellrider. Settings: map: Dov_MP_Orocia era: Ageless Era XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 22:37:24< dicplobby> 20120326 22:37:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 22:38:46< lobby> darky ended game: "Neuromancer’s game" (9568) at turn: 18 with reason: 'game over'. (socket: 14736) 20120326 22:40:05< tuxlobby> 20120326 22:40:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 22:40:09< lobby> I am in. 20120326 22:40:20< lobby> ok :) 20120326 22:40:26< lobby> ill host in a bit 20120326 22:40:27< lobby> Velociraptor ended game: "La partida de Velociraptor" (9734) at turn: 11 with reason: 'aborted'. (socket: 14982) 20120326 22:40:34< lobby> just waiting for ally to finish his game 20120326 22:40:38< lobby> anybody else? :) 20120326 22:40:47< lobby> b00mbear started game: "b00mbears Partie" (9744) with: b00mbear, Adi. Settings: map: user_map era: era_default XP: 40 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 22:40:54< lobby> Mulzaro started game: "Mulzaro’s game" (9746) with: Mulzaro, kallewarrior. Settings: map: multiplayer_4p_Hamlets era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 22:41:00< lobby> KalenzZ advanced game: "Jeu de KalenzZ" (9552) with: KalenzZ, Xplosivman. Settings: map: CSABI_Leaving_the_Island era: XP: 100% GPV: fog: shroud: observers: shuffle: timer: 20120326 22:41:03< lobby> 20120326 22:41:03 Statistics: number_of_games = 63 number_of_users = 196 lobby_users = 40 20120326 22:41:16< lobby> screwtop ended game: "nome de skarlatus" (9721) at turn: 11 with reason: 'out of sync'. (socket: 14698) 20120326 22:41:20< lobby> I just asked someone. 20120326 22:41:53< lobby> Velociraptor started game: "La partida de Velociraptor" (9749) with: Velociraptor. Settings: map: isars_blasphemy era: Ageless Era XP: 50 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 22:41:57< lobby> 25th_Baam started game: "25th Baam" (9745) with: 25th_Baam, Menzo. Settings: map: PSRZA_City era: PSRZA_ZombieApocalypse XP: 100 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 22:42:19< lobby> Slealista ended game: "Battaglia di KisukeUrahara" (9703) at turn: 11 with reason: 'aborted'. (socket: 14867) 20120326 22:42:21< lobby> me if nooene plays ladder with me 20120326 22:42:24< dicplobby> 20120326 22:42:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 22:42:24< lobby> sagi3347 ended game: "La partida de Kalyra" (9640) at turn: 24 with reason: 'game over'. (socket: 14824) 20120326 22:42:34< lobby> hehe. 20120326 22:42:42< lobby> that someone doesn't stand any chance against Daunt. 20120326 22:42:58< lobby> Practice, practice and practice. 20120326 22:43:03< lobby> KisukeUrahara started game: "Battaglia di KisukeUrahara" (9752) with: KisukeUrahara, Slealista. Settings: map: multiplayer_4p_Morituri era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 22:43:08< lobby> Thiagolamen ended game: "nome de johnny" (9658) at turn: 24 with reason: 'game over'. (socket: 14849) 20120326 22:43:10< lobby> can i have two sides then? 20120326 22:43:13< lobby> daunt? 20120326 22:43:17< lobby> nate-the-great ended game: "nate-the-great’s game" (9693) at turn: 45 with reason: 'aborted'. (socket: 14848) 20120326 22:43:18< lobby> sure. 20120326 22:43:39< lobby> ok...host? 20120326 22:43:55< lobby> KalenzZ ended game: "Jeu de KalenzZ" (9552) at turn: 1 with reason: 'game over'. (socket: 14656) 20120326 22:43:58< lobby> the last real practices I had were against neki and Rigor, and that was about a year ago :p 20120326 22:44:02< lobby> irene ended game: "Battaglia di irene" (9699) at turn: 12 with reason: 'aborted'. (socket: 14671) 20120326 22:44:13< lobby> enclave started game: "enclave’s game" (9751) with: enclave, ges55, MeSSiaH, sagi3347. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 22:44:32< lobby> yes, hosting 20120326 22:44:46< lobby> lets paly 2v2 though 20120326 22:44:55< lobby> we have one vacant slot in game 'MadMode@' (SX) if anyone is interested to join... 20120326 22:44:56< lobby> come play crend ;) 20120326 22:45:05< tuxlobby> 20120326 22:45:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 22:45:11< lobby> nah, sorry, really neither the skill nor the time needed :( 20120326 22:45:11< lobby> ilikeblue949 started game: "joining will probably waste your time" (9760) with: ilikeblue949. Settings: map: SXC_Stronghold_0.2.98 era: era_magic_0.18.0 XP: 130 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 22:45:26< lobby> don't want to have to quit after a few turns 20120326 22:45:26< lobby> who comes in my game 20120326 22:45:35< lobby> ilikeblue949 ended game: "joining will probably waste your time" (9760) at turn: 1 with reason: 'aborted'. (socket: 15034) 20120326 22:45:49< lobby> moonchild ended game: "GL & HF" (9732) at turn: 7 with reason: 'aborted'. (socket: 15000) 20120326 22:45:56< lobby> Miguis ended game: "nome de Miguis" (9619) at turn: 33 with reason: 'aborted'. (socket: 14592) 20120326 22:46:05< lobby> 20120326 22:46:05 Statistics: number_of_games = 61 number_of_users = 197 lobby_users = 48 20120326 22:46:10< lobby> i got skills and time dauntless 20120326 22:46:19< lobby> I want to make the card with the rounds 20120326 22:46:38< lobby> Zenzsei: then join his game? 20120326 22:47:21< lobby> AnairabiS ended game: "Игра artifis" (9707) at turn: 12 with reason: 'aborted'. (socket: 14939) 20120326 22:47:24< dicplobby> 20120326 22:47:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 22:47:40< lobby> artifis started game: "Игра artifis" (9767) with: artifis, AnairabiS. Settings: map: Ferox_4p_Wesmere_Border_Assault era: Ageless Era XP: GPV: fog: shroud: observers: no shuffle: no timer: 20120326 22:47:40< lobby> Wepawetmose ended game: "raleehas Partie" (9725) at turn: 6 with reason: 'aborted'. (socket: 14965) 20120326 22:48:16< lobby> nate-the-great started game: "Latter" (9755) with: nate-the-great, Ranimiro, raleeha, RaFa. Settings: map: isars_blasphemy era: Ageless Era XP: 60 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 22:48:20< lobby> anyone up for a ladder? 20120326 22:48:35< lobby> me 20120326 22:48:44< lobby> moonchild started game: "GL & HF" (9765) with: moonchild, vector, Dakar, mike. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 22:48:45< lobby> AnairabiS ended game: "Игра artifis" (9767) at turn: 11 with reason: 'aborted'. (socket: 14939) 20120326 22:49:09< lobby> artifis started game: "Игра artifis" (9771) with: artifis, AnairabiS. Settings: map: Ferox_4p_Wesmere_Border_Assault era: Ageless Era XP: GPV: fog: shroud: observers: no shuffle: no timer: 20120326 22:49:15< lobby> SaBriNa- started game: "Battaglia di SaBriNa-" (9768) with: SaBriNa-, Silian. Settings: map: multiplayer_Basilisk era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 22:49:24< lobby> Caerre started game: "Not Gay Ben" (9759) with: Caerre, Caliway. Settings: map: Creep War v0.2.11.1 era: Creep_Era_v0.2.11.1 XP: 60 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 22:49:29< lobby> ok 20120326 22:49:31< lobby> i open 20120326 22:49:33< lobby> Rob started game: "Rob’s game" (9743) with: Rob, Hakun, RickDangerous, Psota. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 22:49:57< lobby> Mentat ended game: "Gra użytkownika Agra" (9612) at turn: 25 with reason: 'aborted'. (socket: 14476) 20120326 22:50:05< tuxlobby> 20120326 22:50:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 22:50:05< lobby> Polycentropsis ended game: "goollumms Partie" (9591) at turn: 21 with reason: 'game over'. (socket: 14647) 20120326 22:51:05< lobby> 20120326 22:51:05 Statistics: number_of_games = 61 number_of_users = 198 lobby_users = 41 20120326 22:52:11< lobby> hateech ended game: "Игра boobz" (9690) at turn: 20 with reason: 'game over'. (socket: 14452) 20120326 22:52:15< lobby> FebrezeBrother started game: "FebrezeBrother’s game" (9775) with: FebrezeBrother, Magnesia. Settings: map: multiplayer_Hamlets era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 22:52:24< dicplobby> 20120326 22:52:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 22:53:46< lobby> Jurgen started game: "Era of Myth Survival!" (9754) with: Jurgen, skarlatus, Agra. Settings: map: 3pSurvival era: era_default_and_EOM_5.10.0 svn XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 22:53:50< lobby> Inteliteknia started game: "Ladder game" (9776) with: Inteliteknia, Zenzsei. Settings: map: RMP_All era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 22:53:58< lobby> Inteliteknia advanced game: "Ladder game" (9776) with: Inteliteknia, Zenzsei. Settings: map: RMP_Tombs_of_Kesorak_12 era: XP: 70 GPV: fog: shroud: observers: shuffle: timer: 20120326 22:55:05< tuxlobby> 20120326 22:55:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 22:55:43< lobby> Choppy ended game: "random" (9647) at turn: 13 with reason: 'game over'. (socket: 14868) 20120326 22:56:05< lobby> 20120326 22:56:05 Statistics: number_of_games = 62 number_of_users = 192 lobby_users = 35 20120326 22:56:09< lobby> Nagiv ended game: "Quack quack!" (9607) at turn: 25 with reason: 'game over'. (socket: 14827) 20120326 22:56:11< lobby> Dauntless2 started game: "Dauntless2’s game" (9762) with: Dauntless2, torben, Gwledig, Snowman. Settings: map: multiplayer_Xanthe_Chaos era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 22:56:41< lobby> Felixus ended game: "Felixuss Partiesersok" (9682) at turn: 18 with reason: 'game over'. (socket: 14900) 20120326 22:56:55< lobby> suchst du ne runde aus oder ich? 20120326 22:56:56< lobby> machst du eins auf? 20120326 22:57:00< lobby> ok 20120326 22:57:24< dicplobby> 20120326 22:57:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 22:57:57< lobby> Inteliteknia ended game: "Ladder game" (9776) at turn: 2 with reason: 'game over'. (socket: 15011) 20120326 22:58:10< lobby> paso started game: "Jeu de paso" (9780) with: paso. Settings: map: SXRPG WizardOfWarII era: Ageless RPG Era XP: 130 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 22:58:12< lobby> FiMiAM ended game: "Игра Panfil-Ugly" (9388) at turn: 52 with reason: 'aborted'. (socket: 14416) 20120326 22:58:23< lobby> Agra ended game: "Era of Myth Survival!" (9754) at turn: 1 with reason: 'out of sync'. (socket: 14625) 20120326 22:58:37< lobby> Felixus started game: "Felixuss Partie" (9784) with: Felixus, Wolfsfell. Settings: map: multiplayer_The_Freelands era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 22:58:48< lobby> ilikeblue949 started game: "join at a little risk, im not sure if this era will work" (9781) with: ilikeblue949. Settings: map: SXC_Stronghold_0.2.98 era: era_magic_0.18.0 XP: 130 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 22:58:59< lobby> Inteliteknia started game: "Ladder for Zenzsei" (9785) with: Inteliteknia, Zenzsei. Settings: map: RMP_Conservative Adventurous era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 22:59:01< lobby> Inteliteknia advanced game: "Ladder for Zenzsei" (9785) with: Inteliteknia, Zenzsei. Settings: map: RMP_Fallenstar_Lake_12 era: XP: 70 GPV: fog: shroud: observers: shuffle: timer: 20120326 22:59:12< lobby> misterx100 started game: "misterx100s Partie" (9774) with: misterx100, screwtop. Settings: map: multiplayer_6p_Team_Survival era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 23:00:00< lobby> fail ended game: "La partida de fail" (9692) at turn: 18 with reason: 'aborted'. (socket: 14787) 20120326 23:00:05< tuxlobby> 20120326 23:00:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 23:00:30< lobby> Crelda started game: "Crelda’s game" (9782) with: Crelda, NotCraig. Settings: map: multiplayer_Random_Map era: era_default XP: 50 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 23:00:39< dicplobby> joueur has logged on. (socket: 74) 20120326 23:00:56< lobby> Kalyra ended game: "La partida de Kalyra" (9714) at turn: 8 with reason: 'aborted'. (socket: 14836) 20120326 23:00:56< lobby> Dauntless started game: "Dauntless’s game" (9787) with: Dauntless, Snowman, Atmohspheer, kilopop. Settings: map: multiplayer_Xanthe_Chaos era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 23:01:03< lobby> Agra started game: "Gra użytkownika Agra" (9786) with: Agra, deor, skarlatus. Settings: map: 3pSurvival era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 23:01:13< lobby> 20120326 23:01:13 Statistics: number_of_games = 60 number_of_users = 185 lobby_users = 38 20120326 23:02:05< lobby> NotCraig ended game: "Crelda’s game" (9782) at turn: 1 with reason: 'aborted'. (socket: 15020) 20120326 23:02:10< lobby> Hellrider ended game: "Hellrider’s game" (9742) at turn: 9 with reason: 'aborted'. (socket: 15007) 20120326 23:02:17< lobby> Zenzsei ended game: "Ladder for Zenzsei" (9785) at turn: 2 with reason: 'game over'. (socket: 14345) 20120326 23:02:24< dicplobby> 20120326 23:02:24 Statistics: number_of_games = 0 number_of_users = 1 lobby_users = 1 20120326 23:02:27< lobby> Kalyra started game: "La partida de Kalyra" (9790) with: Kalyra, clmates. Settings: map: vs_Survival_2p era: Dov_XP_Mod XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 23:02:38< lobby> AnairabiS ended game: "Игра artifis" (9771) at turn: 18 with reason: 'game over'. (socket: 14939) 20120326 23:03:07< dicplobby> joueur has logged off. (socket: 74) 20120326 23:03:15< lobby> Horus2 ended game: "Dauntless2’s game" (9762) at turn: 1 with reason: 'aborted'. (socket: 14955) 20120326 23:04:02< lobby> Roger ended game: "1 vs 1 . two sides each" (9610) at turn: 15 with reason: 'out of sync'. (socket: 14818) 20120326 23:04:18< lobby> ilikeblue949 ended game: "join at a little risk, im not sure if this era will work" (9781) at turn: 4 with reason: 'aborted'. (socket: 15047) 20120326 23:05:05< tuxlobby> 20120326 23:05:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 23:05:14< lobby> t4 ended game: "mihkelh’s game" (9729) at turn: 10 with reason: 'aborted'. (socket: 14709) 20120326 23:05:20< lobby> Zoe ended game: "Maxwell’s game" (9662) at turn: 19 with reason: 'game over'. (socket: 14857) 20120326 23:05:32< lobby> mihkelh started game: "mihkelh’s game" (9795) with: mihkelh, t4. Settings: map: multiplayer_Forest_of_Fear era: era_default XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 23:06:13< lobby> 20120326 23:06:13 Statistics: number_of_games = 58 number_of_users = 186 lobby_users = 43 20120326 23:06:17< lobby> KLASHINKOOV ended game: "CRAZYpotatos RUMBLE in the BRONXXXXX" (9736) at turn: 37 with reason: 'game over'. (socket: 14805) 20120326 23:06:20< lobby> ping 20120326 23:06:33< lobby> hen ended game: "jveino’s game" (9629) at turn: 18 with reason: 'aborted'. (socket: 14784) 20120326 23:06:52< lobby> Crelda started game: "Crelda’s game" (9792) with: Crelda, NotCraig. Settings: map: multiplayer_Random_Map era: era_heroes XP: 50 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 23:07:09< lobby> basiir ended game: "basiir’s game" (9711) at turn: 17 with reason: 'aborted'. (socket: 14707) 20120326 23:07:10< lobby> FadeToBlack started game: "FadeToBlacks spel" (9796) with: FadeToBlack, Stenen_, Nephrite, kickass. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 23:07:24< dicplobby> 20120326 23:07:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 23:08:02< lobby> Visionary started game: "Ladder" (9799) with: Visionary, Zenzsei. Settings: map: RBY Conservative 10 era: RBY No Mirror XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 23:08:13< lobby> Visionary advanced game: "Ladder" (9799) with: Visionary, Zenzsei. Settings: map: RBY Weldyn Channel 12 era: XP: 70 GPV: fog: shroud: observers: shuffle: timer: 20120326 23:08:59< lobby> spoko 20120326 23:09:25< lobby> MeSSiaH ended game: "enclave’s game" (9751) at turn: 6 with reason: 'aborted'. (socket: 14718) 20120326 23:10:05< tuxlobby> 20120326 23:10:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 23:10:08< lobby> Velociraptor ended game: "La partida de Velociraptor" (9749) at turn: 22 with reason: 'aborted'. (socket: 14982) 20120326 23:10:20< lobby> Alfeno started game: "Battaglia di Alfeno" (9798) with: Alfeno, enclave, MeSSiaH, Druid. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 23:10:21< lobby> eternity started game: "La partida de eternity" (9800) with: eternity. Settings: map: multiplayer_Random_Map era: GLE XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 23:11:01< lobby> chocoboner started game: "chocoboner’s game" (9783) with: chocoboner, Aroda, KLASHINKOOV. Settings: map: user_map era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 23:11:13< lobby> 20120326 23:11:13 Statistics: number_of_games = 56 number_of_users = 183 lobby_users = 40 20120326 23:11:51< lobby> Paxe ended game: "Yubtzock’s game" (9713) at turn: 7 with reason: 'aborted'. (socket: 14976) 20120326 23:12:07< lobby> Fari ended game: "Gra użytkownika Argi12148" (9741) at turn: 18 with reason: 'game over'. (socket: 14860) 20120326 23:12:24< dicplobby> 20120326 23:12:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 23:13:32< lobby> Tommy started game: "Tommy’s game" (9803) with: Tommy, torgul, CleverFool, Paxe. Settings: map: multiplayer_Auction-X era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 23:14:59< lobby> goldfrog started game: "random" (9791) with: goldfrog, gdn, Dakar, FwSchulzi. Settings: map: Creep War v0.2.11.1 era: Ageless RPG Era XP: 60 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 23:15:05< tuxlobby> 20120326 23:15:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 23:15:09< lobby> infinity3 started game: "infinity3’s game" (9810) with: infinity3. Settings: map: user_map era: RBY No Mirror XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 23:15:35< lobby> infinity3 ended game: "infinity3’s game" (9810) at turn: 1 with reason: 'aborted'. (socket: 15097) 20120326 23:16:13< lobby> 20120326 23:16:13 Statistics: number_of_games = 56 number_of_users = 180 lobby_users = 35 20120326 23:16:13< lobby> Epicuro started game: "RPG! Ageless" (9779) with: Epicuro, ithaxa, Wicia777, basiir, GroberKeiler. Settings: map: SXRPG TheEvilDead era: Ageless RPG Era XP: 60 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 23:17:00< lobby> Bunsenbrandt started game: "Bunsenbrandts Partie" (9689) with: Bunsenbrandt, chrissen. Settings: map: multiplayer_Siege_Castles era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 23:17:15< lobby> Epicuro ended game: "RPG! Ageless" (9779) at turn: 1 with reason: 'game over'. (socket: 15030) 20120326 23:17:24< dicplobby> 20120326 23:17:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 23:17:40< lobby> Gregor started game: "Nightmare" (9805) with: Gregor, Dart_Nader, shapeshifter. Settings: map: World_Conquest_Start era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 23:18:07< lobby> universe started game: "Jeu de universe" (9816) with: universe. Settings: map: World_Conquest_Start era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 23:18:12< lobby> so many games 20120326 23:18:33< lobby> Joeisidle started game: "Joeisidle’s game" (9802) with: Joeisidle, paddyisidle. Settings: map: multiplayer_Sablestone_Delta era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 23:18:35< lobby> universe ended game: "Jeu de universe" (9816) at turn: 1 with reason: 'aborted'. (socket: 14811) 20120326 23:19:46< lobby> wth 20120326 23:19:48< lobby> Silian ended game: "Battaglia di SaBriNa-" (9768) at turn: 9 with reason: 'game over'. (socket: 15027) 20120326 23:19:51< lobby> OMFG WTH 20120326 23:20:02< lobby> MISSSCLICK 20120326 23:20:05< tuxlobby> 20120326 23:20:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 23:20:11< lobby> lol 20120326 23:20:18< lobby> open again 20120326 23:20:31< lobby> som1 remake 20120326 23:21:13< lobby> 20120326 23:21:13 Statistics: number_of_games = 57 number_of_users = 184 lobby_users = 38 20120326 23:21:29< lobby> 0_o started game: "nome de 0_o" (9811) with: 0_o, Prokon, sugar, Barabash. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 23:21:39< lobby> niemoge dojść 20120326 23:22:24< dicplobby> 20120326 23:22:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 23:22:29< lobby> SaBriNa- started game: "Battaglia di SaBriNa-" (9824) with: SaBriNa-, Silian. Settings: map: multiplayer_Den_of_Onis era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 23:23:04< lobby> Epicuro started game: "La partida de Epicuro" (9814) with: Epicuro, Wicia777, ithaxa, basiir. Settings: map: SXRPG TheEvilDead era: Ageless RPG Era XP: 130 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 23:23:22< lobby> oh ffs 20120326 23:23:36< lobby> or maybe someone has bad wes version? 20120326 23:23:41< lobby> i have 1.10.0 20120326 23:23:45< lobby> Camero0 ended game: "jakflash’s game" (9733) at turn: 11 with reason: 'aborted'. (socket: 14664) 20120326 23:24:09< lobby> scales started game: "scales’s game" (9836) with: scales. Settings: map: multiplayer_Island_of_the_Horatii era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 23:24:34-!- noy [~Noy@wesnoth/developer/noy] has quit [Quit: noy] 20120326 23:24:39< lobby> nezam started game: "nezam’s game" (9829) with: nezam, GreyFyre, xivarmy, yarik. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 23:25:05< tuxlobby> 20120326 23:25:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 23:26:13< lobby> 20120326 23:26:13 Statistics: number_of_games = 61 number_of_users = 184 lobby_users = 30 20120326 23:26:28< lobby> lunamatic ended game: "rumple’s game" (9718) at turn: 58 with reason: 'game over'. (socket: 14942) 20120326 23:26:46< lobby> Jurgen started game: "La partida de Jurgen" (9839) with: Jurgen. Settings: map: multiplayer_Ladder2000 era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 23:26:53< lobby> parah started game: "parah’s game" (9831) with: parah, aimp, Camero0, Made-in-Germany. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 23:26:57< lobby> mortalenemy ended game: "hraje Isar" (9605) at turn: 22 with reason: 'aborted'. (socket: 14802) 20120326 23:27:02< lobby> so are we allowed to use profanity in game? 20120326 23:27:03< lobby> drakow ended game: "milites.pl i druzyna warki czerwonej 5,7% alkoholu" (9621) at turn: 26 with reason: 'aborted'. (socket: 14820) 20120326 23:27:20< lobby> vector ended game: "GL & HF" (9765) at turn: 10 with reason: 'aborted'. (socket: 14981) 20120326 23:27:24< dicplobby> 20120326 23:27:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 23:27:26< lobby> kallewarrior ended game: "Mulzaro’s game" (9746) at turn: 12 with reason: 'game over'. (socket: 15012) 20120326 23:27:38< lobby> meganoob ended game: "Tatiana’s game" (9407) at turn: 32 with reason: 'aborted'. (socket: 14434) 20120326 23:27:38< lobby> Alexian ended game: "Alexian’s game" (9717) at turn: 19 with reason: 'game over'. (socket: 14846) 20120326 23:28:36< lobby> kamil started game: "Gra użytkownika kamil" (9821) with: kamil, GroberKeiler, Mentat, zumbies, ilikeblue949, Wicia777. Settings: map: Colosseum_scenario era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 23:28:39< lobby> reyeskeli started game: "reyeskeli’s game" (9840) with: reyeskeli, nvink. Settings: map: multiplayer_The_Manzivan_Traps era: era_default XP: 30 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 23:28:43< lobby> Mulzaro started game: "Mulzaro’s game" (9841) with: Mulzaro, kallewarrior. Settings: map: multiplayer_Loris_River era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 23:28:59< lobby> Jurgen ended game: "La partida de Jurgen" (9839) at turn: 2 with reason: 'aborted'. (socket: 15101) 20120326 23:29:08< lobby> Spieler34 ended game: "Eldirian’s game" (9712) at turn: 17 with reason: 'game over'. (socket: 14921) 20120326 23:29:27< lobby> Gwledig started game: "THIS IS CONQUEST - NO LEADER, NO KEEP, RIGHT CLICK UR VILAS TO RECRUIT, +GOLD IF YOU HOLD ALL VILAS IN A COUNTRY" (9807) with: Gwledig, herniuk, Jurjin, universe, noob111, artase. Settings: map: Conquest Jel'wan era: era_default XP: 100 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 23:29:55< lobby> drakow started game: "nome de drakow" (9842) with: drakow. Settings: map: 3pSurvival era: era_default XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 23:30:05< tuxlobby> 20120326 23:30:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 23:31:11< lobby> Nicholas started game: "La partida de Nicholas" (9844) with: Nicholas, noob111, Soni. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 23:31:13< lobby> 20120326 23:31:13 Statistics: number_of_games = 58 number_of_users = 180 lobby_users = 33 20120326 23:31:54< lobby> drakow ended game: "nome de drakow" (9842) at turn: 25 with reason: 'aborted'. (socket: 14820) 20120326 23:32:08< lobby> drakow started game: "nome de drakow" (9847) with: drakow. Settings: map: 3pSurvival era: era_default XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 23:32:09< lobby> Psota ended game: "Rob’s game" (9743) at turn: 8 with reason: 'game over'. (socket: 15031) 20120326 23:32:14< lobby> SaBriNa- ended game: "Battaglia di SaBriNa-" (9824) at turn: 3 with reason: 'aborted'. (socket: 15001) 20120326 23:32:23< lobby> O_Q started game: "Игра O_Q" (9846) with: O_Q. Settings: map: SXC_MountainsOfDoom_0.2.98 era: Ageless RPG Era XP: 130 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 23:32:24< dicplobby> 20120326 23:32:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 23:33:00< lobby> drakow ended game: "nome de drakow" (9847) at turn: 23 with reason: 'aborted'. (socket: 14820) 20120326 23:33:25< lobby> drakow started game: "nome de drakow" (9848) with: drakow. Settings: map: 3pSurvival era: era_default XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 23:34:09< lobby> Jurgen started game: "Great legend Era Survival!!!" (9843) with: Jurgen. Settings: map: ice era: GLEE XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 23:34:36< lobby> bluewolf27 ended game: "bluewolf27’s game" (9730) at turn: 42 with reason: 'game over'. (socket: 14980) 20120326 23:34:42< lobby> O_Q ended game: "Игра O_Q" (9846) at turn: 3 with reason: 'aborted'. (socket: 14843) 20120326 23:35:05< tuxlobby> 20120326 23:35:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 23:35:27< lobby> Pyrophage started game: "Pyrophage’s game" (9812) with: Pyrophage, Yubtzock, Tobain, okmo. Settings: map: multiplayer_The_Manzivan_Traps era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 23:35:44< lobby> zamuniel ended game: "Karacole’s game" (9477) at turn: 22 with reason: 'game over'. (socket: 14402) 20120326 23:35:49< lobby> scales ended game: "scales’s game" (9836) at turn: 8 with reason: 'aborted'. (socket: 15108) 20120326 23:35:58-!- noy [~Noy@wesnoth/developer/noy] has joined #wesnoth-mp-lobby-stable 20120326 23:36:01-!- mode/#wesnoth-mp-lobby-stable [+o noy] by ChanServ 20120326 23:36:02< lobby> Orgasm ended game: "Orgasm’s game" (9723) at turn: 19 with reason: 'game over'. (socket: 14959) 20120326 23:36:08-!- noy [~Noy@wesnoth/developer/noy] has quit [Client Quit] 20120326 23:36:13< lobby> 20120326 23:36:13 Statistics: number_of_games = 54 number_of_users = 181 lobby_users = 37 20120326 23:36:32< lobby> Dart_Nader ended game: "Nightmare" (9805) at turn: 5 with reason: 'aborted'. (socket: 15096) 20120326 23:36:32< lobby> wrypage started game: "wrypage’s game" (9852) with: wrypage. Settings: map: multiplayer_Waterloo_Sunset era: era_heroes XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 23:37:24< dicplobby> 20120326 23:37:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 23:37:56< lobby> fail started game: "La partida de fail" (9856) with: fail. Settings: map: 2vs2Survival era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 23:38:25< lobby> iGotcha started game: "iGotcha’s game" (9850) with: iGotcha, Spieler34, playe. Settings: map: 3pSurvival era: XP_MOD_Heroes XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 23:38:30< lobby> Sander ended game: "Heilige_Henk1’s game" (9656) at turn: 21 with reason: 'game over'. (socket: 14874) 20120326 23:38:38< lobby> Adi ended game: "b00mbears Partie" (9744) at turn: 29 with reason: 'game over'. (socket: 14997) 20120326 23:38:41< lobby> Gregor started game: "Nightmare" (9853) with: Gregor, shapeshifter, universe. Settings: map: World_Conquest_Start era: era_default XP: 80 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 23:39:02< lobby> 25th_Baam ended game: "25th Baam" (9745) at turn: 83 with reason: 'aborted'. (socket: 15014) 20120326 23:39:21< lobby> clap started game: "clap’s game" (9857) with: clap. Settings: map: multiplayer_A_New_Land era: era_default XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 23:39:46< lobby> KisukeUrahara ended game: "Battaglia di KisukeUrahara" (9752) at turn: 17 with reason: 'game over'. (socket: 14871) 20120326 23:39:57< lobby> Joeisidle ended game: "Joeisidle’s game" (9802) at turn: 7 with reason: 'aborted'. (socket: 15065) 20120326 23:40:00-!- noy [~Noy@wesnoth/developer/noy] has joined #wesnoth-mp-lobby-stable 20120326 23:40:04-!- mode/#wesnoth-mp-lobby-stable [+o noy] by ChanServ 20120326 23:40:05< tuxlobby> 20120326 23:40:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 23:40:22< lobby> Daszto ended game: "Schafans Partie" (9599) at turn: 18 with reason: 'aborted' and disconnected. (socket: 14830) 20120326 23:41:07< lobby> O_Q started game: "Игра O_Q" (9855) with: O_Q, davebar, UT_MWKICH, Visionary2. Settings: map: SXC_CursedLand_0.2.98 era: Ageless RPG Era XP: 130 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 23:41:13< lobby> 20120326 23:41:13 Statistics: number_of_games = 53 number_of_users = 181 lobby_users = 42 20120326 23:41:30< lobby> Bare-havoc ended game: "Bare-havoc’s game" (8598) at turn: 24 with reason: 'aborted'. (socket: 12219) 20120326 23:42:00< lobby> BigJohn started game: "BigJohn’s game" (9861) with: BigJohn, evea, Johnnybaker. Settings: map: 3pSurvival era: Ageless Era XP: 60 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 23:42:24< dicplobby> 20120326 23:42:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 23:42:25< lobby> Henrys55 started game: "hraje Henrys55" (9862) with: Henrys55, Majo. Settings: map: Dov_MP_Deep_Shrine era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 23:44:07< lobby> Made-in-Germany ended game: "parah’s game" (9831) at turn: 4 with reason: 'aborted'. (socket: 15077) 20120326 23:44:19< lobby> Menzo started game: "Menzos Partie" (9865) with: Menzo, 25th_Baam. Settings: map: Save The village era: era_default XP: 60 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 23:44:39< lobby> drakow ended game: "nome de drakow" (9848) at turn: 23 with reason: 'aborted'. (socket: 14820) 20120326 23:44:57< lobby> drakow started game: "nome de drakow" (9867) with: drakow. Settings: map: 3pSurvival era: era_default XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 23:45:06< tuxlobby> 20120326 23:45:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 23:45:33< lobby> Magnesia ended game: "FebrezeBrother’s game" (9775) at turn: 14 with reason: 'game over' and disconnected. (socket: 15042) 20120326 23:45:41< lobby> Visionary started game: "Ladder" (9866) with: Visionary, Voices. Settings: map: RBY Conservative 10 era: RBY No Mirror XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 23:45:43< lobby> Visionary advanced game: "Ladder" (9866) with: Visionary, Voices. Settings: map: RBY Weldyn Channel 12 era: XP: 70 GPV: fog: shroud: observers: shuffle: timer: 20120326 23:46:13< lobby> 20120326 23:46:13 Statistics: number_of_games = 52 number_of_users = 173 lobby_users = 42 20120326 23:47:24< dicplobby> 20120326 23:47:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 23:47:57< lobby> Made-in-Germany started game: "2 vs 2" (9868) with: Made-in-Germany, Roger, Zltor01, Radar. Settings: map: multiplayer_Isars_Cross era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 23:49:53< lobby> Zenzsei ended game: "Ladder" (9799) at turn: 15 with reason: 'game over'. (socket: 14345) 20120326 23:50:01< lobby> Fix3l ended game: "Marus Partie" (9716) at turn: 11 with reason: 'game over'. (socket: 14785) 20120326 23:50:06< tuxlobby> 20120326 23:50:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 23:50:24< lobby> gdn ended game: "random" (9791) at turn: 18 with reason: 'game over'. (socket: 14891) 20120326 23:50:31< lobby> drakow ended game: "nome de drakow" (9867) at turn: 22 with reason: 'aborted'. (socket: 14820) 20120326 23:50:45< lobby> not yet 20120326 23:50:46< lobby> drakow started game: "nome de drakow" (9869) with: drakow. Settings: map: 3pSurvival era: era_default XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 23:51:12< lobby> ofire ended game: "La partida de pos_no" (9636) at turn: 12 with reason: 'game over'. (socket: 14840) 20120326 23:51:13< lobby> 20120326 23:51:13 Statistics: number_of_games = 48 number_of_users = 167 lobby_users = 45 20120326 23:51:14< lobby> dont know 20120326 23:51:37< lobby> drakow ended game: "nome de drakow" (9869) at turn: 21 with reason: 'aborted'. (socket: 14820) 20120326 23:51:37< lobby> anyone up for a laddermatch???? 20120326 23:51:47< lobby> drakow started game: "nome de drakow" (9872) with: drakow. Settings: map: 3pSurvival era: era_default XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 23:52:15< lobby> whats a laddermatch? 20120326 23:52:22< lobby> 25th_Baam ended game: "Menzos Partie" (9865) at turn: 3 with reason: 'aborted'. (socket: 15160) 20120326 23:52:24< dicplobby> 20120326 23:52:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 23:53:13< lobby> Auran started game: "Auran’s game" (9871) with: Auran, Dart_Nader, Playa, goldfrog, Thunder917, Polonia. Settings: map: Creep War v0.2.11.1 era: era_default XP: 60 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 23:53:30< lobby> screwtop ended game: "misterx100s Partie" (9774) at turn: 16 with reason: 'aborted'. (socket: 14698) 20120326 23:54:03< lobby> people fighting over points in order to form a pecking order 20120326 23:54:10< lobby> Menzo started game: "Menzos Partie" (9873) with: Menzo, 25th_Baam. Settings: map: sow_classic era: era_default XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 23:54:36< lobby> Horus2 started game: "Hornshark Necroing Experiment 025 - Horus vs Dauntless" (9870) with: Horus2, Dauntless2. Settings: map: 2p_Hornshark_Island_0 era: RBY No Mirror XP: 70 GPV: fog: shroud: observers: yes shuffle: yes timer: 20120326 23:54:54< lobby> Gorolanius started game: "nome de Gorolanius" (9874) with: Gorolanius. Settings: map: Colosseum_scenario era: Heroic_Last_Stand_era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 23:55:03< lobby> Snowman ended game: "Dauntless’s game" (9787) at turn: 8 with reason: 'aborted'. (socket: 14837) 20120326 23:55:05< tuxlobby> 20120326 23:55:05 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 23:55:41< lobby> Gorolanius ended game: "nome de Gorolanius" (9874) at turn: 1 with reason: 'aborted'. (socket: 15082) 20120326 23:56:03< lobby> drakow ended game: "nome de drakow" (9872) at turn: 22 with reason: 'aborted'. (socket: 14820) 20120326 23:56:12< lobby> drakow started game: "nome de drakow" (9877) with: drakow. Settings: map: 3pSurvival era: era_default XP: GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 23:56:13< lobby> 20120326 23:56:13 Statistics: number_of_games = 50 number_of_users = 156 lobby_users = 40 20120326 23:56:56< lobby> Dhill started game: "La partida de Dhill" (9875) with: Dhill, janga, screwtop, Mentat. Settings: map: multiplayer_Auction-X era: Ageless Era XP: 70 GPV: fog: shroud: observers: no shuffle: no timer: 20120326 23:56:57< lobby> Jurgen ended game: "Great legend Era Survival!!!" (9843) at turn: 11 with reason: 'aborted'. (socket: 15101) 20120326 23:57:24< dicplobby> 20120326 23:57:24 Statistics: number_of_games = 0 number_of_users = 0 lobby_users = 0 20120326 23:57:27< lobby> GroberKeiler ended game: "Gra użytkownika kamil" (9821) at turn: 14 with reason: 'aborted'. (socket: 15099) 20120326 23:57:50< lobby> 25th_Baam ended game: "Menzos Partie" (9873) at turn: 5 with reason: 'aborted'. (socket: 15173) 20120326 23:58:46< lobby> Gorolanius started game: "nome de Gorolanius" (9876) with: Gorolanius, Miguis. Settings: map: Colosseum_scenario era: Heroic_Last_Stand_era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 23:59:27< lobby> Dart_Nader ended game: "Auran’s game" (9871) at turn: 7 with reason: 'aborted'. (socket: 15096) 20120326 23:59:43< lobby> Minion started game: "Minion’s game" (9879) with: Minion. Settings: map: 3pSurvival era: Ageless Era XP: 70 GPV: fog: shroud: observers: yes shuffle: no timer: 20120326 23:59:47< lobby> abben ended game: "abben játéka" (9727) at turn: 13 with reason: 'aborted'. (socket: 14978) --- Log closed Tue Mar 27 00:00:02 2012